Pet28a

DNA coding for full-length Sj-Cys (GenBank: CAX73577.1) was amplified from total cDNA of S. japonicum adult worms using following primers (forward: 5'-CAG AAT TCA TGC CTT TAT GTT GTG GTG GT G-3'; reverse: 5'-GCC TCG AGT TAG AAA TAA TAG AAA TGT AAC AGC-3') and cloned into pET-28a (+) (Promega, Madison, Wisconsin, USA) using EcoRI and XhoI restriction sites. The sequencing-confirmed recombinant plasmid was transformed into E. coli BL 21. The expression of rSj-Cys was induced with 1 mM isopropylthio-β-galactoside (IPTG, Sigma-Aldrich, Steinheim, Germany) at 37 °C for 5 h. The expressed rSj-Cys with His-tag at N-terminus was purified with a Ni–NTA His* Bind Purification Kit (Merck Millipore, Basilica, Massachusetts, USA). The contaminated endotoxin in purified rSj-Cys was removed by using a ToxOut™ High Capacity Endotoxin Removal Kit (BioVision, Palo Alto, California, USA) and detected by ToxinSensor™ Chromogenic Limulus Amebocyte Lysate (LAL) Endotoxin Assay Kit (GenScript Biotechnology, Nanjing, China) following the manufacturer’s protocol. The concentration of rSj-Cys was measured using Bicinchoninic Acid Protein Assay Kit (Beyotime Biotechnology, Shanghai, China).

The genomes of phage KP32 and KP34 are deposited in the genomic database (GenBank): GQ413937 and GQ413938, respectively. TTPA encoding genes were selected for overexpression. Bacteriophage genes were obtained using polymerase chain reaction (PCR) with the following primers: TTPA from KP32 FW – GGATCCCATATGAACATGCAAGATGCTTAC, RV – GAATTCAAAGCTTACGACCGATGAGACCCT, TTPA from KP34 FW – GGATCCCATATGAGAGAACTTGATGCAATT, RV – GAATTCAAAGCTTAATACCATAAAACGAGCGCG.
The DNA of the bacteriophages was prepared as previously described^{41 (link)}. PCR reactions were conducted using a two-phase program. The first phase consisted of seven and the second phase of 23 cycles. Taq polymerase (Fermentas) was used and the extension times for each gene were appropriate to gene length, min. 30 seconds to max. 2 minutes. Annealing temperature in the first phase was 48–52 °C and in the second phase 55–65 °C.
PCR products were cloned into the pGEM T-easy vector (T-vector, Promega) using T4 ligase. Constructs were transformed into E. coli DH5α bacteria using the heat-shock method and sequenced. Correct sequences were recloned into pET28a (Promega) expression vectors to obtain the phage tail proteins with an N-terminal six-histidine tag. Plasmid transformation into the competent E. coli BL21(DE3)plysS (Promega) cells was done using the heat shock method.

Plasmids for bacterial expression and transient mammalian cell expression were in a pcDNA3.1(-) backbone (T7 and CMV promoters; Promega). For purification from bacterial overexpression, Smad3 cDNA sequences (RefSeq NM_016769.4) were sub-cloned to pET28a (Promega). To construct plasmids for dual reporter luciferase assays, Foxp3 promoter sequences (CAGAbox) were amplified and cloned into the pGL3 basic vector to become pGL3-CAGA.