Rneasy spin column

Manufactured by Qiagen

Sourced in United States, Germany, United Kingdom, Spain, Netherlands, Canada

RNeasy spin columns are a laboratory tool designed for the purification of RNA from a variety of sample types. They utilize a silica-based membrane to selectively bind and retain RNA molecules, allowing for efficient extraction and concentration of the desired genetic material.

Automatically generated - may contain errors

Lab products found in correlation

Close spelling variants of this product

RNeasy spin prep columns RNeasy Midi spin columns RNeasy silica-membrane spin-columns RNeasy Quick spin columns RNeasy MiniElute spin columns RNeasy Mini Kit spin columns Mini Spin Columns of RNeasy Mini Kit RNeasy spin column purification RNeasy MinElute spin column kit RNeasy Mini spin columns

241 protocols using rneasy spin column

RNA Extraction from Mouse Uterine Tissues

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from mice uterine tissues by homogenizing the tissues in 1 mL TRIzol (Life Technologies, San Francisco, CA) followed by the addition of 200 uL chloroform to the lysate for phase separation by centrifugation at 13,500 rpm for 15 minutes. RNA in the aqueous phase was then precipitated by the addition of 500 μL isopropanol followed by centrifugation at 13,500 rpm for 10 minutes. The RNA pellet was then washed twice with 1 mL 75% ethanol by centrifugation at 10,500 rpm for 5 minutes. The RNA pellet was allowed to dry and then re-dissolved in nuclease free water. Total RNA was purified via RNeasy spin columns (QIAGEN, Germantown, MD) followed by treatment with Dnase using the TURBO DNA-free kit (Life Technologies). For extraction of RNA from BM and uterine cell cultures, total RNA was extracted by disrupting the cells with 300 uL RLT buffer having β-mercaptoethanol, followed by processing in RNeasy spin columns (QIAGEN) as per the manufacturer’s protocol. This was followed by treatment with Dnase using the TURBO DNA-free kit (Life Technologies).

Tal R., Shaikh S., Pallavi P., Tal A., López-Giráldez F., Lyu F., Fang Y.Y., Chinchanikar S., Liu Y., Kliman H.J., Alderman M I.I.I., Pluchino N., Kayani J., Mamillapalli R., Krause D.S, & Taylor H.S. (2019). Adult bone marrow progenitors become decidual cells and contribute to embryo implantation and pregnancy. PLoS Biology, 17(9), e3000421.

+ Open protocol

+ Expand

Transcriptional Response of Mycobacterium tuberculosis to Nitric Oxide

Check if the same lab product or an alternative is used in the 5 most similar protocols

The Mtb strains were grown to an O.D.₆₀₀ of 0.4 and exposed to 0.5 mM diethylenetriamine-nitric oxide (DETA/NO [Sigma-Aldrich, India]) for 4 h at 37 °C. The experiment was carried out with three independent biological replicates. Total RNA extraction was conducted using the FastRNA® Pro Blue Kit (MP Biomedicals, USA) in accordance with the manufacturer's instruction and further purified using RNeasy spin columns (Qiagen, USA) as described [23 ]. Following purification, the RNA was quantified and assessed for purity by a 2100 Bioanalyzer (Agilent Technologies, Waldbronn, Germany). RNA samples with an RIN (RNA Integrity Number) value > 8 were processed further for sequencing. Ribosomal RNA (16s and 23s rRNA) was removed by hybridization with magnetic beads-coupled oligonucleotide (MICROBExpress Kit, Life Technologies, USA) and concentration of enriched mRNA was quantified by Qubit RNA HS Assay Kit (Life Technologies, USA). RNA-seq was performed as described [23 ]. In brief, libraries were prepared using NEB Next Ultra Directional RNA Library Prep Kit for Illumina (New England Biolabs, USA), according to manufacturer's instructions. The library size distribution and quality were assessed using a high sensitivity DNA Chip (Agilent Technologies, USA) and sequenced in HiSeq 2500 platform (Illumina, USA) sequencer using 1X50 bp single-end reads with 1% PhiX spike-in control.

Anand K., Tripathi A., Shukla K., Malhotra N., Jamithireddy A.K., Jha R.K., Chaudhury S.N., Rajmani R.S., Ramesh A., Nagaraja V., Gopal B., Nagaraju G., Narain Seshayee A.S, & Singh A. (2021). Mycobacterium tuberculosis SufR responds to nitric oxide via its 4Fe–4S cluster and regulates Fe–S cluster biogenesis for persistence in mice. Redox Biology, 46, 102062.

+ Open protocol

+ Expand

Transcriptome Analysis of Stromal Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated from stromal cell lines using the RNeasy mini kit and following the manufacturer’s protocol (Qiagen). Double-stranded cDNA was synthesised in a two-step process. The first strand of cDNA was synthesised using T7-(dT)₂₄ primers and SuperScript II reverse transcriptase (Invitrogen Life Technologies: Mount Waverley, VIC, Australia), followed by second-strand cDNA synthesis. Double-stranded DNA was purified using phenol–chloroform using phase-lock gels (Brinkmann Instruments: Westbury, NY, USA). Subsequent procedures were performed by the Biomolecular Resources Facility (JCSMR, ANU). In vitro transcription and biotin labelling were performed using the BioArray High Yield RNA Transcript Labelling Kit (Affymetrix). cRNA was cleaned using RNeasy Spin columns (Qiagen), fragmented and then labelled with biotin. Fragmented and labelled cRNA was hybridized to Human Gene 1.0ST GeneChips® following the manufacturer’s procedure (Affymetrix: Santa Clara, CA, USA). These were washed and stained on the fluidics station (Affymetrix) ahead of scanning and image analysis using a Gene Array Scanner (Affymetrix). Scanned images of GeneChips were processed using Microarray Suite 5.0 software (MAS5.0; Affymetrix).

Petvises S., Tran V., Hey Y.Y., Talaulikar D., O’Neill T.J., Tan J, & O’Neill H.C. (2022). Extramedullary hematopoiesis: mesenchymal stromal cells from spleen provide an in vitro niche for myelopoiesis. In Vitro Cellular & Developmental Biology. Animal, 58(5), 429-439.

+ Open protocol

+ Expand

SFN mRNA Expression Analysis by qPCR

Check if the same lab product or an alternative is used in the 5 most similar protocols

SFN mRNA was measured by real-time PCR. Total RNA was extracted from the cells using RNeasy spin columns (Qiagen, Hilden, Germany). The extracted total RNA was then quantitatively measured using a One Step SYBR PrimeScript RT-PCR Kit (Takara, Kyoto, Japan) and the ABI PRISM 7700 PCR thermal cycler. The β-actin gene (ACTB) was used as the internal standard. The PCR primers with the following sequences were used: SFN-F, 5′-TGACGACAAGAAGCGCATCAT; SFN-R, 5′-GTAGTGGAAGACGGAAAAGTTCA; ACTB-F 5′-CACCATTGGCAATGAGCGGTTC; ACTB-R, 5′-AGGTCTTTGCGGATGTCCACGT.

Arakawa N., Ushiki A., Abe M., Matsuyama S., Saito Y., Kashiwada T., Horimasu Y., Gemma A., Tatsumi K., Hattori N., Tsushima K., Miyashita K., Saito K., Nakamura R., Toyoda T., Ogawa K., Sato M., Takamatsu K., Mori K., Nishiya T., Izumi T., Ohno Y., Saito Y, & Hanaoka M. (2022). Stratifin as a novel diagnostic biomarker in serum for diffuse alveolar damage. Nature Communications, 13, 5854.

+ Open protocol

+ Expand

Quantitative Real-Time PCR Analysis of RNA Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated from PBMC using RNeasy spin columns as described by the manufacturer (Qiagen, Hilden, Germany). Isolated RNA was treated with DNase (Qiagen) and stored at −80 °C for later analysis. RNA concentrations and purity were assessed by spectrophotometer absorbance (NanoDrop ND-1000 Thermo Scientific, Wilmington, DE). 500 ng of RNA was loaded into the cDNA synthesis using q-Script cDNA Synthesis kit (Quanta Bioscience, Gaithersburg, MD). Quantification of mRNA was performed using Perfecta SYBR Green qPCR Fast Mastermix (Quanta Bioscience) on the 7900HT Fast Real-Time PCR System (Applied Biosystems, Foster City, CA) with the accompanying software SDS 2.4. All primer sequences can be provided upon request. As small volumes were used in the analyses of human samples, robot pipetting for RT-qPCR reactions was employed. For each transcript, RT-qPCR was conducted in duplicate. Target transcript levels were quantified by the comparative Ct method using the average Ct-median value from reference genes β-actin and GAPDH as endogenous control.

Macpherson M.E., Halvorsen B., Yndestad A., Ueland T., Mollnes T.E., Berge R.K., Rashidi A., Otterdal K., Gregersen I., Kong X.Y., Holven K.B., Aukrust P., Fevang B, & Jørgensen S.F. (2019). Impaired HDL Function Amplifies Systemic Inflammation in Common Variable Immunodeficiency. Scientific Reports, 9, 9427.

+ Open protocol

+ Expand

Quantitative Analysis of Fibrosis and EMT Genes

Check if the same lab product or an alternative is used in the 5 most similar protocols

Expression levels of select genes relevant to fibrosis and EMT [18 (link)] were measured by performing quantitative reverse transcription-PCR (qRT-PCR). Total RNA was isolated from cells using RNeasy spin columns (Qiagen, Germantown, MD, USA) according to the manufacturers’ recommendation. Genomic DNA was digested with DNase (Thermo Scientific) for 60 min. RT-PCR was conducted on the purified RNA according to the manufacturer’s recommendation using a commercially available Superscript™ III Platinum™ One-Step qRT-PCR kit (Invitrogen, Carlsbad, CA, USA), with appropriate primers (Table 1). Relative differences were calculated using the comparative threshold cycle method (ΔΔCt) by normalizing to Ct values of GAPDH (housekeeping gene).

Dunton C.L., Purves J.T., Hughes FM J.r, & Nagatomi J. (2021). BOO induces fibrosis and EMT in urothelial cells which can be recapitulated in vitro through elevated storage and voiding pressure cycles. International urology and nephrology, 53(10), 2007-2018.

+ Open protocol

+ Expand

Gene Expression Analysis by Microarray

Check if the same lab product or an alternative is used in the 5 most similar protocols

Expression of coding mRNA was analyzed by Beijing Capitalbio Technology Co., Ltd, according to our previously reported method^{43 (link)}. Total RNA was extracted using Trizol (Life Technologies). Contaminating DNAs were removed using RNeasy spin columns (Qiagen). The quality of isolated RNA samples was evaluated with an Agilent Bioanalyzer 2100 (Agilent Technologies) and the purified RNA was quantified using a NanoDrop ND-2000 spectrophotometer (Thermo Fisher). The Agilent Gene Expression oligo microarrays and miRNA microarrays were analyzed using Agilent Gene Expression oligo microarrays Version 6.5, May 2010 and Agilent miRNA microarrays Version 2.3. The R software (v.2.13.0) platform was applied to analyze the microarray data, and the LIMMA (linear regression model) package was used to statistically analyze differentially expressed genes. Genes having a fold change >2 or <−2 and an adjusted p < 0.05 were considered as differentially expressed.

Qi H., Li Y., Yun H., Zhang T., Huang Y., Zhou J., Yan H., Wei J., Liu Y., Zhang Z., Gao Y., Che Y., Su X., Zhu D., Zhang Y., Zhong J, & Yang R. (2019). Lactobacillus maintains healthy gut mucosa by producing L-Ornithine. Communications Biology, 2, 171.

+ Open protocol

+ Expand

Quantitative Analysis of Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was isolated by QIAGEN RNeasy spin columns and reverse-transcribed into cDNA using Superscript II Reverse Transcriptase (Invitrogen). Quantitative real-time PCR of ACTB, LIF, and PRDM1 was performed using the following primers: ACTB forward, 5′-ACCTTCTACAATGAGCTGCG-3′, ACTB reverse, 5′- CCTGGATAGCAACGTACATGG-3′; LIF forward, 5′-ATACGCCACCCATGTCAC-3′, LIF reverse, 5′- CCACATAGCTTGTCCAGGTTG-3′; and PRDM1 forward, 5′-TGTGGTATTGTCGGGACTTTG-3′, PRDM1 reverse 5′-CTTTGGGACATTCTTTGGGCCTG-3′. The following primers were used to quantify the expression of ACVR1B (ALK4), ACVR2A, ACVR2B and INHBA: GAPDH forward, 5′-ACATCGCTCAGACACCATG-3′, GAPDH reverse 5′-TGTAGTTGAGGTCAATGAAGGG-3′, ACVR1B forward, 5′-GGAAGCAGAGATATACCAGACG-3′, ACVR1B reverse, 5′-AGATAATCAAACAGGGACCCG-3′, ACVR2A forward, 5′-CCTGGAATGAAGCATGAGAAC-3′, ACVR2A reverse, 5′-TTCCAAGAGACCACATTAGCC-3′, ACVR2B forward, 5′-GAGATCTTCAGCACACCTGG-3′, ACVR2B reverse, 5′-GATGTTCCCCTTGAGGTAATCC-3′, INHBA forward, 5′-ACGGGTATGTGGAGATAGAGG-3′, and INHBA reverse, 5′-TGGAAATCTCGAAGTGCAGC-3′. Real-time PCR was set up with Applied Biosystem SYBR Green Master Mix.

Locci M., Wu J., Arumemi F., Mikulski Z., Dahlberg C., Miller A.T, & Crotty S. (2016). Activin A programs human TFH cell differentiation. Nature immunology, 17(8), 976-984.

+ Open protocol

+ Expand

Robust RNA Extraction and qPCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was isolated by phenol chloroform extraction followed by high salt precipitation (0.8 M sodium acetate, 1.5 M NaCl) to avoid contaminating polysaccharides to co-precipitate with RNA. Extracted RNA was further purified using RNeasy spin columns (#74104; QIAGEN, Hilden, Germany). Isolated RNA (500 ng) was reverse transcribed into cDNA using SuperScript III Reverse Transcriptase (Invitrogen, Thermo Fisher Scientific, Waltham, MA, USA) and random hexamer primers. qPCR was performed with 1 µL of the cDNA synthesis reaction using Kapa SYBR FAST qPCR Master Mix (KapaBiosystems, Roche, Basel, Switzerland) on a Bio-Rad CFX96 Touch™ Real-Time PCR Detection System. Gene expression was normalized against the expression of TATA-binding protein (Tbp). Assay primers were designed with Primer-BLAST software (NCBI, Bethesda, MD, USA) [28 (link)]. Sequences are listed in Supplementary Table S1.

Fan Q., Nørgaard R.C., Bindesbøll C., Lucas C., Dalen K.T., Babaie E., Itkonen H.M., Matthews J., Nebb H.I, & Grønning-Wang L.M. (2017). LXRα Regulates Hepatic ChREBPα Activity and Lipogenesis upon Glucose, but Not Fructose Feeding in Mice. Nutrients, 9(7), 678.

+ Open protocol

+ Expand

RNA Isolation and Gene Expression Analysis of IL-18 and IL-18bp in HAoEC

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was obtained from HAoEC by using RNeasy spin columns (QIAGEN, Hilden, Germany). Samples were subjected to DNase treatment (RNase-Free DNase Set; QIAGEN) and stored at -80 °C until further analysis. cDNA synthesis was performed using qScript cDNA Supermix (Quanta Bio, Beverly, MA 01,915). Gene expression was examined by real-time quantitative (q)PCR. mRNA detection of IL-18 and IL-18bp and the reference gene β-actin was assessed with SybrGreen primers (Sigma Aldrich, St. Louis, MO 63103): IL-18, forward primers (FP): TCTTCATTGACCAAGGAAATCGG, reverse primers (RP): TCCGGGGTGCATTATCTCTAC; IL-18bp, FP: TGGAAGTGCCACTGAATGGA, RP: CCATTGCCCAGCCAGTAGAG; β-actin, FP: AGGCACCAGGGCGTGAT, RP: TCGTCCCAGTTGGTGACGAT. The relative mRNA level of each transcript was calculated by the ΔΔCt-method and normalized to controls.

Otterdal K., Berg A., Michelsen A.E., Yndestad A., Patel S., Gregersen I., Halvorsen B., Ueland T., Langeland N, & Aukrust P. (2021). IL-18 and IL-18 binding protein are related to disease severity and parasitemia during falciparum malaria. BMC Infectious Diseases, 21, 1073.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!