Recombinant HUNK protein was purchased from ThermoFisher (Invitrogen, #A30974). For kinase reactions, the kinase was incubated in kinase buffer (20 mM HEPES, pH 7.3 and 2 mM MgCl), 100 µM cold ATP, 10 µCi of γ-32P-ATP (PerkinElmer) and substrate: human Rubicon protein (Novus Biologicals, H00009711); Beclin-1 (Ray Biotech, #228-21395-2); UVRAG (MyBioSource, MBS1365072); and Atg14L (MyBioSource, MBS1449868). All kinase reactions were incubated at 30 °C for 20 min. For GST-Rubicon kinase assays, Flag-HUNK was expressed in 293T cells and isolated using anti-Flag affinity beads (Sigma, M8823). Kinase was eluted using Flag peptide (Sigma, F3290). Eluted kinase was mixed with GST-Rubicon and GST-S44/92A Rubicon and incubated in kinase buffer (20 mM HEPES, pH 7.3 and 2 mM MgCl) and 1 mM ATP. Kinase reactions were incubated at 30 °C for 20 min. Anti-phosphoserine antibody (Abcam, #9332) was used to detect Rubicon phosphorylation. GST-Rubicon and GST-S44/92A Rubicon were generated by cloning amino acids 1-271 of Rubicon into pGEX6P. pcDNA6-GFP-Rubicon-Flag was used to PCR amplify amino acids 1-271 of Rubicon. PCR primers: Forward primer: 5′ CATGGTCCTGCTGGAGTTCGTG 3′, Reverse primer: 5′ GAATTCTTTAATCATTGATCCTCTGC 3′. PCR product was digested with BamHI and EcoRI and ligated into pGEX6P.
Antiphosphoserine antibody
Manufactured by Abcam
Sourced in United Kingdom
Antiphosphoserine antibody is a laboratory reagent used to detect and quantify phosphorylated serine residues in proteins. It is a specific antibody that binds to phosphorylated serine and can be used in various analytical techniques, such as Western blotting, immunoprecipitation, and immunohistochemistry, to study protein phosphorylation, a common post-translational modification involved in various cellular processes.
Automatically generated - may contain errors
Lab products found in correlation
γ 32p atp, by PerkinElmer (1 mentions)
Flag peptide, by Merck Group (1 mentions)
Anti flag affinity beads, by Merck Group (1 mentions)
Protein a g plus agarose bead, by Santa Cruz Biotechnology (1 mentions)
Sb216763, by Merck Group (1 mentions)
Anti flag m2 magnetic bead, by Merck Group (1 mentions)
Anti flag, by Merck Group (1 mentions)
Protease inhibitor cocktail, by Roche (1 mentions)
Flag m2 agarose, by Merck Group (1 mentions)
Anti p53 antibody do 1, by Santa Cruz Biotechnology (1 mentions)
Polyvinylidene difluoride membrane, by Merck Group (1 mentions)
Anti actin antibody, by Cell Signaling Technology (1 mentions)
Anti gapdh antibody, by Santa Cruz Biotechnology (1 mentions)
Anti p38 mapk antibody, by Cell Signaling Technology (1 mentions)
Enhanced chemiluminescence, by GE Healthcare (1 mentions)
Anti phospho threonine antibody, by Cell Signaling Technology (1 mentions)
Anti p16 antibody, by BD (1 mentions)
Anti notch1 antibody, by Santa Cruz Biotechnology (1 mentions)
Anti phospho sapk jnk thr183 tyr185 antibody, by Cell Signaling Technology (1 mentions)
Anti id1 antibody, by Santa Cruz Biotechnology (1 mentions)
6 protocols using antiphosphoserine antibody
1
HUNK Kinase Phosphorylation of Rubicon
2
Assessing NDRG1 Phosphorylation by GSK3β
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Glycogen synthase kinase 3-beta (GSK3b) kinase inhibitor (SB216763) was purchased from Sigma-Aldrich. To determine the phosphorylation status of NDRG1, immunoprecipitation was used to pull down the NDRG1 protein, followed by an in vitro phosphorylation assay, similarly as previously described [57 (link),58 (link),59 (link)]. Briefly, Protein A/G PLUS-agarose beads (Santa Cruz Biotechnology, Dallas, TX, USA) with an anti-GFP antibody were used to precipitate NDRG1 proteins. After elution of the immunoprecipitated complex, the protein solution was subjected to an in vitro kinase assay by incubation with recombinant GSK3b protein (Sigma-Aldrich, St. Louis, MO, USA) in a solution containing ATP. Phosphorylated proteins were subjected to SDS-PAGE analysis, and the phosphorylation status of NDRG1 was determined by hybridization with an anti-phosphoserine antibody (Abcam, Cambridge, UK). Alternatively, NDRG1-FL- or NDRG1-Dc-transfected cells were treated with GSK3b-specific inhibitor (SB21673) at various doses for 24 h. Cellular proteins were extracted and subjected to a pulldown assay with an anti-GFP antibody. The phosphorylation status of NDRG1 was revealed by phospho-serine-specific immunoblotting.
3
Phosphorylation of ADF by CDPK in vitro
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
In vitro phosphorylation was performed following in the presence of 4 μm CDPK, 16 μm ADF and 4 μm ATP following Allwood et al. (2001 ). All proteins were dephosphorylated with calf intestinal phosphatase (CIP, New England Biolabs, Ipswich, MA) prior to phosphorylation. Following phosphorylation, His‐tagged ADF was immunoprecipitated with anti‐His antibody and protein A/G sepharose (Pierce, Waltham, MA), eluted in low pH, and dialysed (Methods S1 ). The protein fractions were immunoblotted with antiphosphoserine antibody (Abcam, Cambridge, MA). The membrane was CIP‐treated prior to blocking with rabbit serum. Membrane was developed using ECL chemiluminescence kit (Pierce) following the manufacturer's instructions.
4
ABA-Induced Serine Phosphorylation of SAPK10 and bZIP72
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The experiments were performed as described previously (Zhou et al., 2018 ) with a few modifications. SAPK10‐FLAG and bZIP72‐FLAG overexpression lines were hydroponically cultured for 2 wk, then transferred to the solutions containing different concentrations of ABA (0, 25, 50, 100 µM) for 6 h, respectively. Then the seedlings of SAPK10‐FLAG or bZIP72‐FLAG were harvested and ground into fine powders in liquid nitrogen and resuspended in protein extraction buffer (25 mM Tris‐HCl, pH 7.4, 150 mM NaCl, 1 mM EDTA, 1% NonidetP‐40, and 5% glycerol, 1 mM PMSF, 20 μM MG132, and 1 × Roche protease inhibitor cocktail (Roche). After brief centrifugation twice (12 000 g for 10 min each time), the resulting supernatant was incubated with anti‐FLAG M2 magnetic beads (Sigma‐Aldrich) at 4°C for 1 h. The beads were washed five times with washing buffer (50 mM Tris, pH 7.5, 150 mM NaCl, 0.2 % Triton X‐100, 1 mM PMSF, and 1 × Roche protease inhibitor cocktail). Bound proteins were eluted with 50 μl of 1 × PBS and 10 μl of 6 × SDS loading buffer, boiled for 5 min, and resolved on 10% acrylamide gels. The serine phosphorylation of SAPK10‐FLAG and bZIP72‐FLAG were detected using antiphosphoserine antibody. The dilution for antiphosphoserine antibody (Abcam, Cambridge, UK) and anti‐FLAG (Sigma‐Aldrich) antibodies was 1 : 5000.
5
Quantifying ABF1 Phosphorylation in Rice
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The experiment was carried out as previously reported with minor modifications [34] , [35] (link). Two-week-old seedlings of Nipponbare and OxSAPK8 lines were treated with different concentrations of ABA (0, 10, 25, 100 µM) for 4 h, respectively. Equal amount (2 g) of each sample was ground into fine powders in liquid nitrogen and resuspended in protein extraction buffer (25 mM Tris-HCl, pH 7.4, 1 mM EDTA, 150 mM NaCl, 5% glycerol, 1% NonidetP-40, 0.12% Roche protease inhibitor cocktail and 1 mM PMSF). After twice centrifugation (14000g for 5 min each time), the supernatant was incubated with ABF1 antibody at room temperature for 1 h, then added with 200 µL cleaned Protein A/G Agarose Resin 4 FF (YESEN Biotech, Shanghai, China) mix upside down gently and incubate 30 more minutes at room temperature. After series of centrifugation and washing, the immunoprecipitated ABF1 proteins were directly eluted with 6 × SDS buffer and detected by immunoblot with antiphosphoserine antibody (Abcam, Cambridge, UK) or ABF1 antibody (Genescript, Shanghai, China) at the dilution rate of 1:5000. CIAP treatment was done by incubating the proteins with 0.5 Unit of CIAP at 37 °C for 1 h. The immune signals were quantified using Quantity tools of Image J software.
6
Detecting Protein Modifications by Western Blotting
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Lysates were resolved by SDS-polyacrylamide gel electrophoresis. Proteins were transferred to a polyvinylidene difluoride membrane (Millipore, Bedford, MA, USA), which was incubated with the primary antibody followed by incubation with anti-rabbit, anti-mouse, or anti-goat immunoglobulin-G conjugated with horseradish peroxidase (Jackson ImmunoResearch, West Grove, PA, USA). Specific proteins were detected by using enhanced chemiluminescence (GE Healthcare, Backinghamshire, UK). The primary antibodies for Western blotting were as follows: anti-Notch1 antibody (Santa Cruz, Dallas, TX, USA), anti-Jagged1 antibody (Santa Cruz), anti-p53 antibody (DO-1) (Santa Cruz), anti-p21 antibody (Millipore, Billerica, MA, USA), anti-p16 antibody (BD Pharmingen, San Jose, CA, USA), anti-ID1 antibody (Santa Cruz), anti-phospho p38MAPK (Thr180/Tyr182) antibody (Cell signaling, Boston, MA, USA), anti-p38MAPK antibody (Cell signaling), anti-phospho SAPK/JNK (Thr183/Tyr185) antibody (Cell Signaling), anti-JNK1/3 antibody (Santa Cruz), anti-actin antibody (Cell signaling), anti-GAPDH antibody (Santa Cruz), anti-phosphoserine antibody (Abcam, Cambridge, UK) and anti-phosphothreonine antibody (Cell signaling). To assess the phosphorylation level of Id1, cell lysates were immunoprecipitated with FLAG M2 agarose (Sigma).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!