Milli q instrument

Branched PEI (molecular weight 1.8k and 25k Da) and anhydrous ethylene dichloride (EDC) were purchased from Sigma-Aldrich. 2,6-pyridinedicarboxaldehyde (PDA) was obtained from TCI (Shanghai) Development Co., Ltd. Cellulose membranes (MWCO = 10,000 Da), Roswell Park Memorial Institute-1640 (RPMI-1640) medium, Fetal Bovine Serum (FBS), and Phosphate Buffered Saline (PBS, pH 7.4 basic) were purchased from Thermo Fisher Scientific (Shanghai). Escherichia coli bacterial strain DH5a was obtained from Tiangen Biotech (Beijing) CO., Ltd. The plasmids pVEGF165 and pGFP were constructed previously in our laboratory. Water was purified using a milli-Q instrument (Millipore).

Polyethylenimine 1.8 kDa and 25 kDa and anhydrous ethylene dichloride were purchased from Sigma-Aldrich. 2,6-PDA was purchased from TCI (Shanghai) Development Co., Ltd. Cellulose membranes (MWCO 10,000 Da) were purchased from Thermo Scientific. Poly (ethylene glycol) (PEG) standards kit (ranging from 106 to 20,100 Da in molecular weight) was purchased from Polymer Standards Service GmbH. Water was purified using a milli-Q instrument (Millipore). All the reagents were used without further purification. For TNF-α gene silencing, Plasmid DNA encoding green fluorescence protein (GFP) and mouse TNF-α shRNA were constructed by Bioroot Biology (Shanghai, China) according to a previous report that used the following sequence: 5′-GACAACCAACUAGUGGUGCdTdT-3′. The RAW 264.7 macrophage cell line was purchased from the cell bank of the Chinese Academy of Sciences (Shanghai, China).

Acetonitrile (UHPLC supergradient ACS quality) and methanol (Chromasolv^TM for HPLC, ≥99.9%) were provided by PanReac AppliChem (Barcelona, Spain). Formic acid (≥98%) was obtained from Sigma-Aldrich (St Louis, MO, USA). Water was purified with an Elix 3 system coupled to a Milli-Q instrument from Millipore Corporation (Bedford, MA, USA). The water was filtered with a 0.22 µm nylon membrane filter integrated into the Milli-Q instrument.

Polyethyleneimine 25 KDa (PEI 25 KDa), 1, 4-Butanediol bis (chloroformate), Dimethyl Sulfoxide BioReagent (DMSO, for molecular biology) and ethidium bromide (EB) were purchased from Sigma-Aldich. 5-diphenyltetrazoliumbromide (MTT) was obtained from Solarbio Science & Technology Co., Ltd (Beijing, China). 0.4% Trypan blue solution was purchased from Amresco (Solon, OH). Micro BCA™ Protein Assay Kit was purchased from Thermo Scientific (Rockford, IL). Luciferase Assay Kit was purchased from Promega (Madison, WI). Water was purified using a Milli-Q instrument (Millipore). Other chemicals used were analytical grade.
Dulbecco’s Modified Eagle’s Medium (DMEM), Fetal Bovine Serum Gold (FBS) and Trypsin-EDTA solution were purchased from PAA. Lyso-Tracker™ Green DND-26 was purchased from Invitrogen. pGL3 luciferase gene siRNA and Allstars Negative Control siRNA (Cat. No. 1027280) were obtained from Qiagen. TAMRA labeled siRNA was purchased from GenePharm. All the materials used for siRNA experiments were processed with DEPC to keep RNase free.

Methanol (Chromosolv^TM for HPLC, ≥99.9%) and acetonitrile (UHPLC supergradient ACS quality) were obtained from PanReac AppliChem (Barcelona, Spain), formic acid (≥98%) from Sigma-Aldrich (St Louis, MO, USA), and hydrochloric acid (37%) from Fisher Chemical (Geel, Belgium). Water was purified by employing an Elix 3 system coupled to a Milli-Q instrument from Millipore Corporation (Bedford, MA, USA). The water was filtered with a 0.22 µm nylon membrane filter integrated into the Milli-Q instrument.
All the polyphenolic and phenolic acid compounds used in this work were of analytical grade and were obtained from Sigma-Aldrich, with the exception of hesperidin obtained from Glentham Life Sciences (Lorsham, United Kingdom), astilbin and caftaric acid from Biopurity Phytochemicals Ltd. (Chengdu, Sichuan, China), trans-coumaric acid and procyanidin C1 from Phytolab (Vestenbergsgreuth, Germany), diosmin, hesperetin, and catechol from AlfaAesar Chemicals (ThermoFisher, Kandel, Germany), naringin, naringenin, and epigallocatechin from Biosynth-Carbosynth (Berkshire, United Kingdom), procyanidins B2 and A2 from Extrasynthese (Genay, France), pinocembrin from Fisher Scientific (Madrid, Spain), tricetin and galangin from Cymit Quimica S.L. (Barcelona, Spain), and chrysin and pinobanksin from Merck (Darmstadt, Germany).

Branched PEI (1.8 and 25 kDa), N,N-Dimethylformamide (DMF), agarose and dimethyl sulfoxide were acquired from Sigma-Aldrich (St Louis, MO, USA). 2,5-thiophenedicarboxaldehyde (TDA) was purchased from Meryer (Shanghai) Chemical Technology Co., Ltd. Dialysis bags made by cellulose membrane (MWCO = 10 kDa) were acquired from Thermo Fisher Scientific. A milli-Q instrument (Millipore) was used to purify water. Plasmid DNA expressing mouse-VEGF-shRNA and GFP was constructed by PHY-310 vector (Bioroot Biology, Shanghai, China). The single strain oligonucleotides sequence was 5′- GATCCGATGTGAATGCAGACCAAAGAATTCAAGAGATTCTTTGGTCTGCATTCACATTTTTTTG-3′. Plasmid extraction kits were purchased from Bioteke Corporation. CT26.WT and SMMC7721 cells were purchased from the Cell Bank of Chinese Academy of Sciences (Shanghai, China). The complete medium for cells was composed of 90% Roswell Park Memorial Institute (RPMI) 1640 Medium (Media Tech, Herndon, VA, USA), 9% fetal bovine serum (FBS; HyClone, Logan, UT, USA) and 1% penicillin-streptomycin solution (Gibco, Grand Island, N.Y.). Cell Counting Kit-8 (CCK-8) was purchased from Dojindo Molecular Technologies, Inc. BALB/c mice were obtained from Shanghai Slac Laboratory Animal Co., Ltd.