Screen-printed carbon electrodes were bought from DropSens (Spain). The screen-printed electrodes utilized in this research consisted typically of three electrodes: the carbon working electrode (WE), the carbon counter electrode, and the Ag/AgCl reference electrode (RE). Sulfuric acid (H2SO4), potassium chloride (KCl), magnesium chloride (MgCl2), calcium chloride (CaCl2), sodium chloride (NaCl), Tris–HCl, Hydrogen tetracholoroaurate (HAuCl4), methanol (CH3OH), sodium phosphate dibasic (Na2HPO4), potassium phosphate monobasic (KH2PO4), potassium ferrocyanide (K4[Fe(CN)6]), potassium ferricyanide (K3[Fe(CN)6]), 2-mercaptoethanol (2-MCE), zearalenone (ZEN), Aflatoxin M1 (AFM1) and Aflatoxin B1 (AFB1) were purchased from Sigma-Aldrich. FB1-aptamer ss-HSDNA sequence (5′ SH(CH2)6AGCAGCACAGAGGTCAGATGCGATCTGGATATTATTTTTGATACCCCTTT GGGAGACATCCTATGCGTGCTACCGTGAA-3′) was bought from Thermo Fisher Scientific. Ultrapure water was used to prepare all solutions.
Zearalenone
Manufactured by Merck Group
Sourced in United States, Germany, China, Belgium, Hungary, United Kingdom
Zearalenone is a laboratory analytical standard used for the detection and quantification of zearalenone, a mycotoxin produced by certain Fusarium fungi. It is commonly used in analytical methods such as high-performance liquid chromatography (HPLC) and enzyme-linked immunosorbent assay (ELISA) to measure the presence and concentration of zearalenone in various matrices, including food, feed, and environmental samples.
Automatically generated - may contain errors
Lab products found in correlation
Deoxynivalenol, by Merck Group (22 mentions)
Ochratoxin a, by Merck Group (13 mentions)
Fumonisin b1, by Merck Group (9 mentions)
Milli q system, by Merck Group (8 mentions)
Formic acid, by Merck Group (8 mentions)
Aflatoxin b1, by Merck Group (8 mentions)
Methanol, by Merck Group (7 mentions)
Bovine serum albumin (bsa), by Merck Group (7 mentions)
Nivalenol, by Merck Group (6 mentions)
Acetonitrile, by Merck Group (6 mentions)
T 2 toxin, by Merck Group (6 mentions)
Fetal bovine serum (fbs), by Thermo Fisher Scientific (5 mentions)
Sterigmatocystin, by Merck Group (5 mentions)
Dimethyl sulfoxide (dmso), by Merck Group (4 mentions)
α zearalenol, by Merck Group (4 mentions)
Aflatoxin b2, by Merck Group (4 mentions)
Penicillin streptomycin, by Thermo Fisher Scientific (4 mentions)
Zearalanone, by Merck Group (4 mentions)
β zearalenol, by Merck Group (4 mentions)
Ergosterol, by Merck Group (3 mentions)
72 protocols using zearalenone
1
Electrochemical Mycotoxin Detection System
2
Determination of Mycotoxin Standards
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Ergosterol (ERG), fumonisin B1 (FB1), zearalenone (ZON), deoxynivalenol (DON), and nivalenol (NIV) standards were purchased with a standard grade certificate (purity above 98%) from Sigma-Aldrich (Steinheim, Germany). Stock solutions of standards were prepared in acetonitrile except ERG in methanol at 1.0 mg/mL concentrations and stored at −20 °C. Sodium dihydrophosphate, potassium hydroxide, sodium hydroxide, potassium chloride, acetic acid, hydrochloric acid, and o-phosphoric acid were purchased from POCh (Gliwice, Poland). Organic solvents (HPLC grade), disodium tetraborate, n-pentane, 2-mercaptoethanol, sodium acetate, and all the other chemicals were also purchased from Sigma-Aldrich (Steinheim, Germany). Water for the HPLC mobile phase was purified using a Milli-Q system (Millipore, Bedford, MA, USA).
3
Zearalenone Cytotoxicity in IPEC-J2 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Commercially available zearalenone (Sigma, Z2125, MO, USA) was dissolved in dimethyl sulfoxide (DMSO) (Sigma, D2650, MO, USA) at a concentration of 20 mmol/L and refrigerated at −20 °C prior to use. The IPEC-J2 cells were seeded onto 6-well plates at a density of 1 × 106 cells per well before aliquots of ZEA solution were added to achieve culture concentrations of 0, 10, 20, and 40 μmol/L (Control, ZEA10, ZEA20, ZEA40), respectively. After mixing the cultures, they were incubated at 37 °C for 24 and 36 h, after which the cells were collected for further testing.
4
Zearalenone Purification and Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All reagents (including zearalenone) were purchased from Sigma-Aldrich Company (Germany, Munich).
5
Lipid Monolayer Characterization of Mycotoxins
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Zearalenone, α-Zearalenol, α-Zearalanol and manganese chloride were purchased from Sigma-Aldrich Company (Germany, Munich). 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC) were obtained from Avanti Polar Lipids (USA, Alabaster). Chloroform (Merc, Germany, Munich) was the spreading solvent. Water, which was used as a subphase in the model studies was re-distilled and purified by a Milli-Q system, with a specific resistance above 18.2 MQ cm−1.
All other reagents used for biochemical analysis were obtained from Sigma-Aldrich Company (Germany, Munich).
All other reagents used for biochemical analysis were obtained from Sigma-Aldrich Company (Germany, Munich).
6
Quantitative Analysis of Mycotoxins
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Methanol, acetonitrile (both HPLC gradient grade) and formic acid were purchased from Merck (Darmstadt, Germany). Water was purified by Milli-Q plus system from Millipore (Molsheim, France). Mycotoxins standards and internal standard (zearalenone, ZAN) were purchased from Sigma–Aldrich (Madrid, Spain) and were dissolved in acetonitrile (AFB2, AFG1, ZEA, T2 and ZAN), Methanol (AFB1, AFG2 and OTA) or acetonitrile:water (50:50, v/v) (FB1 and FB2). Stock solutions were prepared with a concentration of 1 mg/mL, except T2, which presented a concentration of 2.5 mg/mL. AFB1, AFB2, AFG1, AFG2, OTA, ZEA, T2, FB1 and FB2 were supplied from Sigma- Aldrich (Table S2 ). These stock solutions were subsequently used to prepare different working solutions for calibrations. All standard solutions were stored in amber vials in the dark at - 20 °C, for at least 2 years, and before use, they were kept at room temperature for 15 min.
Certified reference materials MA1750-1/CM and MA1764/CM from Test Veritas (Padova, Italy) were used to evaluate accuracy of the method.
Certified reference materials MA1750-1/CM and MA1764/CM from Test Veritas (Padova, Italy) were used to evaluate accuracy of the method.
7
Zearalenone Modulates Mouse Leydig Cell Cycle and Apoptosis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Mouse TM3 cells (Leydig cells) were obtained from the Chinese Academy of Sciences (Shanghai, China); Zearalenone was obtained from Sigma Aldrich (St. Louis, MO, USA); DMEM-F12 medium, horse serum (HRS) and fetal bovine serum (FBS) were purchased from Gibco (Grand Island, NY, USA); the cell cycle assay and Annexin V/propidium iodide assay were obtained from Becton Dickinson Company (Franklin Lakes, NJ, USA); the Enhanced BCA Protein Assay Kit (P0010) was purchased from Beyotime (Shanghai, China). Polyclonal antibodies against α-Actin (8547) Cyclin-D1 (2978), ERK1/2 (4695S), P-ERK1/2 (54240), JNK1/2 (9252S), P-JNK1/2 (4668S), P-P38 (4511) P38 (8690) were acquired from Cell Signaling Technology (Boston, MA, USA); the antibody against CDK4 (ab199728) was obtained from Abcam (Cambridge, MA, USA).
8
Radiolabeling and Purification of Zearalenone
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Zearalenone (ZEN), chloramines-T (Ch-T), ethanol and methanol were acquired from Sigma-Aldrich. Aluminum sheets thin layer chromatography (TLC) plates (20 × 25 cm) SG-60 F254 from Merck. All the chemical substances used in this study were of analytical or clinical grade & were directly used no more purification except else was stated. No-carrier-added (NCA) [125I] as NaI (185 MBq/50 μL) diluted in 0.04 M NaOH, pH 9–11 was supplied by the institute of isotopes, Hungary, >99 %. For radioactive measurement A well-type NaI scintillation γ-Counter model Scalar Ratemeter SR7 (Nuclear Enterprises Ltd., USA) was used. The mixture was completely purified using High Performance Liquid Chromatography HPLC column, provided with a Shimadzu model detector SpD-6A (SHIMADZU Cooperation, MD, USA) that contains LC-9A pumps, column Lichrosorb (RP-C18−250 mm × 4.6 mm, 5 μm)., rheodyne injector and UV spectrophotometer detector at 320 nm wavelength. At the optimal conditions an injection of 10 μ from the [125I] ZEN solution was injected in the HPLC. As recommended methanol: water (9:1,v/v/), was The mobile phase moving at 1.0 mL/min rate. Fractions were collected separately from a 1.0 mL volume up to 15 mL volume and counted with a γ-ray scintillation counter [17 ,18 (link)].
9
Fungal Laccase Production and Characterization
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Aflatoxin B1 (AFB1), zearalenone (ZEN), deoxynivalenol (DON), 2,2’-azino-bis(3-ethylbenzothiazoline-6-sulphonic acid (ABTS), 2,6-dimethoxy phenol (DMP), syringaldazine (SGZ), and methyl syringate were purchased from Sigma-Aldrich (St. Louis, MO, USA). FB1 (fumonisin B1) and OTA (ocharatoxin A) were purchased from Pribolab (Beijing, China). DNA polymerase, T4 ligase, acetonitrile, and trifluoroacetic acid were purchased from Thermo Fisher Scientific (Waltham, MA, USA). Vanillin, p-coumaric, syringic acid, syringaldehyde, caffeic acid, 1-hydroxybenzotriazole (HBT), gallic acid, isopropyl-β-D-thiogalactoside (IPTG), and kanamycin were purchased from Solarbio (Beijing, China). Ni-NTA agarose was purchased from QIAGEN (Hilden, Germany). The fungal laccase from Ganoderma sp. was purchased from Sunson (Yinchuan, Ningxia, China). Plant extracts from E. brevicornu, C. sativus L., L. angustifolia, A. officinalis, and S. tenuifolia were purchased from Ciyuan Biotech (Xi’an, Shanxi, China). All other chemicals were of analytical grade or chromatographically pure, and were commercially available.
10
Quantification of Aspergillus and Fusarium Mycotoxins
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Standards used for the quantification of Aspergillus metabolites included AFB1, AFB2, AFG1, AFG2, OTA, and STE, which were acquired from Sigma-Aldrich (Bornem, Belgium). Standards of other Aspergillus metabolites listed in Table 3 were not available hence, they were qualitatively determined. Standards for the quantification of Fusarium metabolites including T-2 toxin (T-2) and DAS were procured from Biopure Referenzsubstanzen (Tulln, Austria). Zearalenone, DON, FB1, FB2, 3-AcDON, 15-AcDON, NEO, NIV, HT-2, and FUS-X were purchased from Sigma-Aldrich (Bornem, Belgium). FB3 was purchased from South African Medical Research Council (Tygerberg, South Africa).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!