Tissue rna purification kit plus

The total RNA from the liver and EAT was isolated using the Tissue RNA Purification Kit PLUS (EZBioscience, Roseville, CA, USA), following the manufacturer’s instructions. The amount and quality of the RNA were determined using a spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA). The Color Reverse Transcription Kit (EZBioscience, Roseville, CA, USA) was used to convert 1 μg of RNA into cDNA. Gene expression was quantified by RT-qPCR reaction using the Light Cycler96 system (Roche). RT-qPCR was performed according to the instructions provided by the 2 × Color SYBR Green qPCR Mix kit (EZBioscience, Roseville, CA, USA). The total volume of the reaction was 20 μL, including 10 μL SYBR Green mix, 2 μL cDNA, 7.2 μL H₂O and 0.4 μL each of forward and reverse primers. The amplification conditions included denaturation at 95 °C for 5 min, followed by 40 cycles of 95 °C for 10 s and 60 °C for 30 s. Finally, a melting curve analysis was performed. The primers are listed in Supplementary Table S1. β-actin was used as a housekeeping gene to normalize target gene transcript levels. The values were expressed using the formula 2^−(ΔΔCt), where ΔΔCt = (Ct Target-Ct β-actin) treatment—(Ct Target-Ct β-actin) model.

Fresh specimens were collected in RNALater (Thermo Fisher Scientific, AM7024) and stored at –80°C. Tissue RNA extraction was performed with a Tissue RNA Purification Kit Plus (EZBioscience, EZB-RN001-plus) according to the manufacturer’s instructions, and cell RNA extraction was performed with an Express RNA Purification Kit (EZBioscience, B0004DP). RNA concentration was quantified using Nanodrop 2000 (Thermo Fisher Scientific) and 1 μg RNA was used for reverse transcription using a Color Reverse Transcriptase Kit (EZBioscience, A0010CGQ). Gene expression was quantified by real-time PCR using SYBR Green qPCR Mix (EZBioscience, A0012-R2) as previously described. The primers used for the detected genes are listed in Supplemental Table 3.

Quantitative real‐time polymerase chain reaction was used to measure the messenger RNA levels of specific M1 and M2 markers in animal models. Cerebral cortices and hippocampal tissues from saline‐perfused brain samples were partitioned and frozen on dry ice immediately. RNA extraction was completed using a Tissue RNA Purification Kit Plus (EZBioscience) following the manufacturer's instructions. RNA concentrations were determined using a NanoDrop spectrophotometer. First‐strand cDNA was synthesized from 500 ng RNA using HiScript III RT SuperMix for qPCR (Vazyme, R323‐01). RT‐PCR was performed using SYBR green reagents (SYBR Master Mix, Vazyme, Q411‐02) on a Light Cycler 480 II machine (Roche). A comparative Ct analysis was used, and GAPDH was used as a housekeeping reference gene. The primers for TNF‐α, IL‐1β, IL‐6, iNOS, IGF‐1, TGFβ, Ym1, IL‐10, and GAPDH are presented in Table 1.

Total RNA was extracted from PDAC tissues using the Tissue RNA Purification Kit PLUS (Cat# EZB-RN001-plus, EZBioscience) following the manufacturer’s instructions. RNA reverse transcription to cDNA was conducted using 4× EZscript Reverse Transcription Mix II (Cat# EZB-RT2GQ, EZBioscience) according to the manufacturer’s protocols. Real-time PCR was performed using a QuantStudio™ 7 Flex Real-Time PCR system (Cat# 4485701, Applied Biosystems). ACTB (β-actin) was used as an internal control. The relative mRNA expression of GFPT1 was normalized to ACTB expression. All reactions were run in triplicate. The primer sequences were as follows: GFPT1 forward, 5-TTGCCTGTGATGGTGGAACT-3; GFPT1 reverse, 5-GTGATATGGAACTGCCAACTGT-3; ACTB forward, 5-CGTGCGTGACATTAAGGAAGAGT-3; and ACTB reverse, 5-GGAAGGAAGGCTGGAAGAGT-3.

After a 21-day chondrogenesis period, the total RNA was isolated using a Tissue RNA Purification Kit Plus (EZBioscience, Roseville, MN, USA) following the manufacturer’s instructions. cDNA synthesis was carried out using a Reverse Transcription Master Mix (EZBioscience). For qRT-PCR, the CFX384 Touch Real-Time PCR Detection System (Bio-Rad, Hercules, CA, USA) was employed along with SYBR Green qPCR Master Mix (ROX2 plus, EZBioscience). The qPCR procedure consisted of an initial hot start at 95 °C for 5 min, followed by 40 cycles of denaturation at 95 °C for 10 s, and annealing/extension at 60 °C for 30 s. The expression levels of glyceraldehyde 3-phosphate dehydrogenase (GAPDH) were used as internal controls to normalize gene expression. The relative mRNA expression levels were determined using the 2^−ΔΔCT method, and the results were presented as fold-increases compared to the control samples. The primer sequences are listed in Table 1.

Total RNA was extracted from the cells treated with control,5uM 3-MA or 0.5 nM Rapa using Trizol (Invitrogen, CA, USA). The mRNA was reverse-transcribed to cDNA using the Tissue RNA Purification Kit Plus (EZBioscience, America) according to the manufacturer’s protocol. The qRT-PCR analysis was performed with Hieff® qPCR SYBR Green Master Mix (YEASEN, China) in a Light Cycle Roche 480 II Real-time PCR system (Roche, Basel Switzerland). Three replicates were analyzed. The primer sequences used for qRT-PCR analysis are listed in Table 1. The expression levels of target genes were normalized with β-actin (internal control).Table 1

Primer sequences for qRT-PCR

Gene	Forward primer (5'-3')	Reverse primer (5'-3')
β-actin	GGGAAATCGTGCGTGACATTAAG	TGTGTTGGCGTACAGGTCTTTG
GLUT1	CTTTGTGGCCTTCTTTGAAGT	CCACACAGTTGCTCCACAT
GLUT3	ATGCCCTACCAATATCCAGCA	GCTCCCAGTGGACTCATCTG
GLUT4	TGCTCGATTATGCACTGGAAGT	ATGAACCCCATACTCCTTCCCAG
MCT1	AAAGTGGTGAGCTGCGACGTGA	CGTTATATGCGCGGATCGCAG
MCT4	GATATGGGCGCTTACCATTTTCG	TGTGCTGCGTGACATTCCAA
PFKL	AGATGCGCACCAGCATCAACG	GAACCCGGCACATTGTTGGA
LDHA	GGAGGACCCAGCAATTAGTCT	GTTCACCCATCGCGGTTTAT
PKM2	ATGGCTGACACATTCCTGGAGC	CCTTCAACGTCTCCACTGATCG