Protein level of epithelial cadherin (E-cadherin, 120/80 kDa), an intercellular adherens junction protein in epithelial barrier, was determined. Total lung proteins were isolated from individual mouse lung homogenate in radioimmunoprecipitation assay buffer (n = 4/group) and equal amounts of the lung proteins from two mice were pooled. Aliquots of pooled proteins (70-150 μg) were separated on Tri-HCl SDS-PAGE genes (7.5% or 10-20%, Bio-Rad) and analyzed by routine Western blotting using specific antibodies (Santa Cruz Biotechnology) against E-cadherin (sc-59778, 1:200 dilution) and pan-actin (sc-1616, 1:500 dilution). Blot images were scanned using the FluorChem HD2 System (ProteinSimple, San Jose, CA) and quantified by densitometry using Image J Gel analysis software (https://imagej.nih.gov ).
Specific antibodies
Manufactured by Santa Cruz Biotechnology
Sourced in United States, Germany
Specific antibodies are protein molecules produced by the immune system that recognize and bind to unique targets, known as antigens. These antibodies are commonly used in various laboratory techniques to detect, isolate, or quantify specific molecules or cells of interest.
Automatically generated - may contain errors
Lab products found in correlation
Whatman, by Cytiva (2 mentions)
Chip it enzymatic kit, by Active Motif (2 mentions)
Ecl system, by Cytiva (2 mentions)
Horseradish peroxidase coupled secondary antibody, by Santa Cruz Biotechnology (1 mentions)
Enhanced chemi luminescence (ecl), by GE Healthcare (1 mentions)
Ventana system, by Roche (1 mentions)
Supersignal west femto maximum sensitivity substrate, by Thermo Fisher Scientific (1 mentions)
Nitrocellulose membrane, by Cytiva (1 mentions)
Horseradish peroxidase conjugated secondary antibody, by Roche (1 mentions)
Anti rabbit or anti mouse igg, by Santa Cruz Biotechnology (1 mentions)
Image lab 4, by Bio-Rad (1 mentions)
Imagequant software, by GE Healthcare (1 mentions)
Pvdf membrane, by Merck Group (1 mentions)
Gradient sds page, by Bio-Rad (1 mentions)
Protein a sepharose beads, by Merck Group (1 mentions)
Odyssey blocking buffer, by LI COR (1 mentions)
Odyssey platform, by LI COR (1 mentions)
Enhanced chemiluminescence reagent, by Merck Group (1 mentions)
Las 3000 imager, by Fujifilm (1 mentions)
Bradford protein assay, by Bio-Rad (1 mentions)
24 protocols using specific antibodies
1
Measuring Epithelial Cadherin Levels in Mouse Lungs
2
Quantifying Notch 1 Protein Levels
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Notch 1, the target gene of miR-146, was detected by western blot analysis following overexpression of miR-146 and shRNA. Cells were lysed using M-PER Protein Extraction Reagent (Pierce) supplemented with a protease inhibitor cocktail (PMSF). Protein concentrations of the extracts were measured using the BCA assays (Pierce) and equalized with extraction reagent. Equal amounts of extracts were loaded and subjected to SDS/PAGE, followed by transfer onto nitrocellulose membranes. Specific antibodies and horseradish peroxidase-coupled secondary antibodies were purchased from Santa Cruz. Membranes were probed using ultra-ECL western blotting detection reagents. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as an internal control.
3
Protein Expression Dynamics in Osteoclastogenesis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The protein expression levels of 2 genes, c-Fos, and NFATc1, were assessed via Western blot analysis [29 (link)]. RAW264.7 cells were grown on Ti and zirconia disks for one, two, and three days after treatment of RANKL. After washing with PBS, total cell lysates were harvested by lysing the cells with chilled radioimmunoprecipitation assay (RIPA) buffer (10 mM Tris pH 7.2, 150 mM NaCl, 5 mM ethylenediaminetetraacetic acid, 1 mM NaF, 2.5 mM sodium pyrophosphate, 1 mM sodium orthovanadate, 1 mM phenylmethylsulfonyl fluoride, 1 μg/mL leupeptin, 1 µg/mL aprotinin, 1% Triton X-100, 0.1% SDS and 1% deoxycholate). Total cell lysates were incubated for 20 min and centrifuged at 14,000× g for 15 min at 4 °C. Harvested proteins were separated by 8% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and transferred to a nitrocellulose membrane (Whatman GmbH, Dassel, Germany). The membrane was probed with specific antibodies (Santa Cruz Biotechnology, Heidelberg, Germany) with a concentration of 2 μg/mL and the reactivity of the immune complexes were detected by using enhanced chemiluminescence (ECL, GE Healthcare, Hatfield, Hertfordshire, UK) reagents.
4
Immunohistochemical Profiling of Mesothelial Markers
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cells were detached using trypsin-EDTA and then washed and centrifuged. The cell pellets were fixed in formalin and embedded in paraffin. Tumor sections were prepared, and immunohistochemical studies were carried out for the mesothelial markers calretinin, WT1, CK5/6, and mesothelin and BAP1 using specific antibodies (Santa Cruz Biotechnology, TX). All immunostaining was carried out using an automated Ventana system (Ventana Medical Systems, AZ) using their UltraView polymer based detection system. IHC staining was scored semiquantitatively as follows: negative (less than 5% of cells stained), 1+ positive (5- 50%), and 2+ positive (50-100%).
5
Western Blot Analysis of CCA-Adding Enzyme
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For western blot analysis total cell lysates or fractions obtained during affinity purification were separated in 10% SDS-PAGE gels.
To investigate the levels of CCA-adding enzyme (CAE) during exponential growth or upon stress cells were pelleted, washed with 1× PBS and cell pellets directly resuspended in Laemmli buffer. The corresponding volume to 2 × 106 cells was run per lane. For analysis of affinity purifications fractions the corresponding to 2–3 × 106 cells of input lysates and flow-through fractions and 2 × 107 cells of final beads were run per lane. Gels were transferred onto a nitrocellulose membrane (Amersham Biosciences) and blocked for 1 h in 1× PBS/0.1% Tween-20 containing 5% nonfat milk. The membranes were incubated with mouse anti–HA antibody (1:5000, Covane) at 4°C overnight, washed (3 × 10 min each with 1× PBS/0.1% Tween-20) and horseradish peroxidase-conjugated secondary antibodies were added (1:3000; Roche). The membranes were washed as before and results were visualized using an enhanced chemiluminescence SuperSignal West Femto Maximum Sensitivity Substrate (ThermoFisher Scientific). As loading control EF1A was detected as before using specific antibodies (1:10 000, Santa Cruz).
To investigate the levels of CCA-adding enzyme (CAE) during exponential growth or upon stress cells were pelleted, washed with 1× PBS and cell pellets directly resuspended in Laemmli buffer. The corresponding volume to 2 × 106 cells was run per lane. For analysis of affinity purifications fractions the corresponding to 2–3 × 106 cells of input lysates and flow-through fractions and 2 × 107 cells of final beads were run per lane. Gels were transferred onto a nitrocellulose membrane (Amersham Biosciences) and blocked for 1 h in 1× PBS/0.1% Tween-20 containing 5% nonfat milk. The membranes were incubated with mouse anti–HA antibody (1:5000, Covane) at 4°C overnight, washed (3 × 10 min each with 1× PBS/0.1% Tween-20) and horseradish peroxidase-conjugated secondary antibodies were added (1:3000; Roche). The membranes were washed as before and results were visualized using an enhanced chemiluminescence SuperSignal West Femto Maximum Sensitivity Substrate (ThermoFisher Scientific). As loading control EF1A was detected as before using specific antibodies (1:10 000, Santa Cruz).
6
Melanogenesis Regulation by Peptide
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Example 11
Melanocytes (B16F10 cell line) were incubated on 6-well culture plates for 24 hours, and were treated with the peptides of the present invention with different concentrations. After 72-hour incubation, the cells were lysed, and the cells were subjected to western blotting using specific antibodies (two types, both from Santa Cruz Biotechnology, USA) to investigate the expression of MITF and tyrosinase, which are factors involved in melanogenesis. The results are shown in
As can be seen from
7
ChIP Assay for Snail Transcription Factor
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The ChIP assay was performed using a ChiP-IT enzymatic kit (Active Motif, Carlsbad, CA) following the manufacturer's instructions. After that, Snail was immunoprecipitated using specific antibodies (Santa Cruz Biotechnology CA, USA). The attached DNA was prepared using proteinase K and further purified using a phenol/chloroform procedure. PCR was performed using the following primer sets:E-box-1, (forward) 5′GCCTGGAACTGGAGGGTAAC'3 and (reverse) 5′GGGAACCCAGCCAAGAGATA'3; E-box-2, (forward) 5′CGTGTCTCGGTGGAACTCTG'3 and (reverse) 5′GTG GCTGCCGGGCTC'3. An amplicon at a distance of 2,116 base pairs upstream of the human miR-128-2 stem-loop was used as negative control: (forward) 5′GTCTTTTCTAAAGGAACAAAACGCT'3 and (reverse) 5′GCTCTGGCAAACTTTGGTGG'3.
8
Western Blot Analysis of siRNA Knockdown
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Seventy‐two hours after siRNA transfection, 32D and Mv1Lu cells (3 × 106 cells) were lysed with 100 µl, 50 mM Tris–HCl, pH 7.0 containing 1% Triton X‐100, 150 mM NaCl, 5 mM EDTA, and 0.1 mM PMSF. Cell lysates were subjected to 7.5% SDS‐PAGE and Western blotting using specific antibodies (Santa Cruz Biotechnology) as described previously.22 (link), 23 (link) The antigens on the blots were visualized using horseradish oxidase‐conjugated anti‐rabbit IgG antibody and ECL system.
9
Western Blot Analysis of Immune Markers
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Isolated ASML cells were lysed, separated by electrophoresis and blotted as described before [48 (link)]. PVDF membranes were probed for different proteins (CcL2, Ccl20, Mmp2, Mmp7, Mmp14 and β-actin) using specific antibodies (Santa Cruz, Biotechnology, Germany) as per manufacturer's instructions. Immunoblots were developed using conjugated anti-mouse or anti-rabbit IgG (Santa Cruz, Biotechnology, Germany) and ECL-System (Amersham Pharmacia Biotech, Munich, Germany). Levels of β-actin were used to normalize the protein expressions. Relative concentrations were assessed from radiographic images using the ImageJ Program.
10
Melanogenesis Regulation by Peptides
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Example 4
Melanocytes (B16F10 cell line) were incubated on 6-well culture plates in an incubator for 24 hours, and were treated with the peptides of the present invention with different concentrations. After 72-hour incubation, the cells were lysed, and the cells were subjected to western blotting using specific antibodies (two types, both by Santa Cruz Biotechnology, USA) to investigate the expression of MITF and tyrosinase, which are the factors involved in melanogenesis. The results are shown in
As can be confirmed from
As can also be confirmed from
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!