Human cd4 microbeads

Manufactured by Miltenyi Biotec

Sourced in Germany, United States

Human CD4 microbeads are designed for the isolation of CD4+ T cells from human samples. They contain antibodies specific to the CD4 surface marker, allowing for the efficient separation and purification of CD4+ cells from complex mixtures.

Automatically generated - may contain errors

Lab products found in correlation

46 protocols using human cd4 microbeads

Isolation and Culture of Naïve CD4+ T Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total CD4⁺ T cells were isolated from PBMCs using human CD4 microbeads (Miltenyi Biotec, Germany), and naïve CD4⁺ T cells were selected by human Naïve CD4⁺ T Cell Isolation Kit (Miltenyi Biotec). Purified cells were then cultured in RPMI 1640 medium (GIBCO, USA) supplemented with 10% fetal bovine serum (GIBCO), and 1% penicillin/streptomycin (Beyotime, China) at 37 °C with 5% CO₂.

Lu S., Wei X., Zhu H., Hu Z., Zheng M., Wu J., Zhao C., Yang S., Feng D., Jia S., Zhao H, & Zhao M. (2023). m6A methyltransferase METTL3 programs CD4+ T-cell activation and effector T-cell differentiation in systemic lupus erythematosus. Molecular Medicine, 29, 46.

+ Open protocol

+ Expand

PBMC Isolation and T Cell Activation

Check if the same lab product or an alternative is used in the 5 most similar protocols

Peripheral blood mononuclear cells (PBMCs) were isolated from commercially available leukocyte cones (NHS Blood and Transplant, Bristol) by density gradient centrifugation. CD4+ and CD8+ T cells were purified from PBMCs by positive selection using magnetic cell separation with human CD4 MicroBeads (130-045-101, Miltenyi Biotec) or human CD8+ T Cell Isolation Kit (Miltenyi Biotec), respectively. Cells were stimulated by addition of 4 μL/10⁶ cells anti-human CD3/CD28 antibody-conjugated beads (Dynabeads Human T-Activator CD3/CD28, 11131D, Thermofisher Scientific).

Crump N.T., Hadjinicolaou A.V., Xia M., Walsby-Tickle J., Gileadi U., Chen J.L., Setshedi M., Olsen L.R., Lau I.J., Godfrey L., Quek L., Yu Z., Ballabio E., Barnkob M.B., Napolitani G., Salio M., Koohy H., Kessler B.M., Taylor S., Vyas P., McCullagh J.S., Milne T.A, & Cerundolo V. (2021). Chromatin accessibility governs the differential response of cancer and T cells to arginine starvation. Cell Reports, 35(6), 109101.

+ Open protocol

+ Expand

Cell Line Selection and Characterization

Check if the same lab product or an alternative is used in the 5 most similar protocols

All cell lines were from ATCC (American Type Culture Collection) and were selected to best reflect the respective cancer entities. Hep3B and SNU387 represent hepatocellular carcinoma, the most common form of liver cancer. The pancreatic cancer cell lines were derived from adenocarcinomas, the most common type of pancreatic cancer. Of these, PANC-1 cells represent pancreatic ductal carcinoma, the most common subtype of pancreatic adenocarcinoma. Adenocarcnimoa also is the most common type of gastric cancer, with NCI-N87 and MKN-45 cells representing well differentiated Lauren intestinal-type gastric adenocarcinoma and poorly differentiated Lauren diffuse-type gastric adenocarcinoma, respectively. Cells were tested routinely for mycoplasma contamination every three months. Authenticity was determined on a regular basis by validating the respective immunophenotype described by the provider using flow cytometry. Peripheral Blood Mononuclear cells (PBMC) of healthy donors were isolated by density gradient centrifugation (Biocoll; Biochrom, Berlin, Germany), and monocytes within the PBMC were depleted for coculture experiments using human CD14 MicroBeads UltraPure kit (Miltenyi Biotec, Bergisch Gladbach, Germany). Where indicated, T cells within PBMC were isolated by using either Pan T cell Isolation Kit, human CD4 Micro Beads or human CD8 Micro Beads (Miltenyi Biotec).

Lutz M.S., Zekri L., Weßling L., Berchtold S., Heitmann J.S., Lauer U.M., Jung G, & Salih H.R. (2023). IgG-based B7-H3xCD3 bispecific antibody for treatment of pancreatic, hepatic and gastric cancer. Frontiers in Immunology, 14, 1163136.

+ Open protocol

+ Expand

Isolation and Culture of Human CD4+ T Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

Human PB mononuclear cells (PBMCs) were isolated using human lymphocyte separation medium (TBDscience, Tianjin, China) according to the manufacturer's instructions. CD4⁺ T cells were purified from PBMCs by a positive magnetic selection strategy using human CD4 MicroBeads (Miltenyi Biotec, Bergisch Gladbach, Germany). The purity of CD4⁺ T-cell population (CD3⁺ CD4⁺) was evaluated by flow cytometric analysis. The method of how to culture CD4⁺ T lymphocytes was described in supplemental methodology (see supplemental methodology, Supplemental Digital Content 1, http://links.lww.com/MD/A225).

Wang X., Wu T., Zhou F., Liu S., Zhou R., Zhu S., Song L., Zhu F., Wang G, & Xia B. (2015). IL12p40 Regulates Functional Development of Human CD4+ T Cells: Enlightenment by the Elevated Expressions of IL12p40 in Patients With Inflammatory Bowel Diseases. Medicine, 94(10), e613.

+ Open protocol

+ Expand

Isolation and Expansion of HIV-1 from Donors

Check if the same lab product or an alternative is used in the 5 most similar protocols

CD4+ T cells were isolated from buffy coats of healthy donors (purchased from ZenBio Inc.) by positive selection using human CD4 micro beads (Miltenyi Biotec) as described (50 (link)). For limiting dilution isolation, plasma samples were end-point diluted and used to infect 1 × 10⁶ activated CD4+ T cells in 24-well plates (50 (link)). To generate bulk isolates, plasma aliquots containing 1,500 – 20,000 viral RNA copies were used to infect 4 × 10⁶ healthy donor CD4+ T cells in 6-well plates. Cultures were maintained for 21 days and tested weekly for the presence of p24 antigen in the supernatant. Virus positive cultures were expanded in 1 × 10⁷ pooled healthy donor CD4+ T cells and the resulting viral stocks were used for all genetic and biological analyses.

Gondim M.V., Sherrill-Mix S., Bibollet-Ruche F., Russell R.M., Trimboli S., Smith A.G., Li Y., Liu W., Avitto A.N., DeVoto J.C., Connell J., Fenton-May A.E., Pellegrino P., Williams I., Papasavvas E., Lorenzi J.C., Salantes D.B., Mampe F., Monroy M.A., Cohen Y.Z., Heath S., Saag M.S., Montaner L.J., Collman R.G., Siliciano J.M., Siliciano R.F., Plenderleith L.J., Sharp P.M., Caskey M., Nussenzweig M.C., Shaw G.M., Borrow P., Bar K.J, & Hahn B.H. (2021). Heightened resistance to type 1 interferons characterizes HIV-1 at transmission and following treatment interruption. Science translational medicine, 13(576), eabd8179.

+ Open protocol

+ Expand

Antibody Reverses AMP-Mediated CD4+ T Cell Suppression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Example 4

This example tests the ability of the antibody to reverse AMP-mediated CD4+ T cell suppression.

Human CD4+ T cells were purified from PBMCs by positive selection using the human CD4 microbeads (Miltenyi Biotech). Isolated CD4+ T cells were stimulated with pre-coated anti-CD3 antibody (2 μg/ml) and soluble anti-CD28 antibody (1 ug/ml) in the presence or absence of AMP (500 μM). Serial dilutions of anti-CD73 antibodies and control IgGs were added into each well and cultured for 72 hrs and the supernatant was analyzed for IFN-γ by ELISA. As shown in FIG. 6, 101-Mu dose-dependently increased IFN-γ production of the CD4+ cells, while the control had no relevant impact.

US11613577B2. Anti-CD73 antibodies and uses thereof (2023-03-28). I-MAB Biopharma US Limited [MD]. Inventors: Zhengyi Wang [CN], Lei Fang [CN], Bingshi Guo [CN], Jingwu Zang [CN].

+ Open protocol

+ Expand

Isolation and Stimulation of Primary Human T Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

Peripheral blood mononuclear cells were isolated from peripheral blood of healthy donors (n = 1 male, n = 2 female, age 38 ± 7) by density centrifugation. Primary human Pan T cells were then isolated using magnetic beads (Pan T cell isolation kit, #130-096-535, Miltenyi Biotec), followed by CD4 (human CD4 microbeads, #130-045-101, Miltenyi Biotech) or CD8 (human CD8 microbeads, #130-045-201, Miltenyi Biotec) isolation. Defined numbers of cells were stimulated with platebound anti-CD3 and anti-CD28 antibodies (0.75 µg/ml; # 555329, # 555329, BD Biosciences) for 10 min, 1 h or 6 h, or were left unstimulated. Stimulated T cells were collected after 10 min, 30 min, 1 h, 6 h, 12 h, or 24 h stimulation and RNA was isolated for subsequent real time PCR analysis with the following primers: IL17A (fw: CAATCCCCAGTTGATTGGAA; rev: CTCAGCAGCAGTAGCAGTGACA), IFNG (fw: TCAGCCATCACTTGGATGAG; rev: CGAGATGACTTCGAAAAGCTG), IL13 (fw: TGACAGCTGGCATGTACTGTG; rev: GGGTCTTCTCGATGGCACTG), 18 S (fw: GTAACCCGTTGAACCCCATT; rev: CCATCCAATCGGTAGTAGCG).

Schäbitz A., Hillig C., Mubarak M., Jargosch M., Farnoud A., Scala E., Kurzen N., Pilz A.C., Bhalla N., Thomas J., Stahle M., Biedermann T., Schmidt-Weber C.B., Theis F., Garzorz-Stark N., Eyerich K., Menden M.P, & Eyerich S. (2022). Spatial transcriptomics landscape of lesions from non-communicable inflammatory skin diseases. Nature Communications, 13, 7729.

+ Open protocol

+ Expand

Enrichment of Immune Cell Subsets

Check if the same lab product or an alternative is used in the 5 most similar protocols

Single-cell suspensions were thawed for each patient and filtered through a 40-μm filter into complete media (described above). Samples were enriched for CD8⁺, CD4⁺, and CD45⁻ cells (on ice) using three sequential rounds of positive selection by magnetic bead separation using MicroBeads (Miltenyi) according to the manufacturer’s protocol. Briefly, cells were resuspended in cell enrichment buffer (described above) and counted. Cells were incubated at 4°C for 15 min with Human CD8 MicroBeads, Human CD4 MicroBeads, or Human CD45 MicroBeads (Miltenyi) and then washed with cell enrichment buffer. Samples were passed through the LS column (Miltenyi), and both the positive and negative fractions were collected. To reduce the duration and maximize the cell recovery steps, CD8⁻ fraction was subsequently used for a second round CD4⁺ enrichment, and the CD4⁻ fraction was used for the subsequent CD45⁻ enrichment. Solutions were kept on ice throughout the duration of the separation.

Kilgour M.K., MacPherson S., Zacharias L.G., Ellis A.E., Sheldon R.D., Liu E.Y., Keyes S., Pauly B., Carleton G., Allard B., Smazynski J., Williams K.S., Watson P.H., Stagg J., Nelson B.H., DeBerardinis R.J., Jones R.G., Hamilton P.T, & Lum J.J. (2021). 1-Methylnicotinamide is an immune regulatory metabolite in human ovarian cancer. Science Advances, 7(4), eabe1174.

+ Open protocol

+ Expand

Isolation and Culture of Human PBMCs and CD4+ T Cells

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Human peripheral blood mononuclear cells (PBMCs) were isolated by density-gradient centrifugation over Ficoll-Hypaque solution (Haoyang Biological Technology Co., Tianjin, China) and stored at -80°C for quantitative real-time polymerase chain reaction (qRT–PCR). Human CD4⁺ T cells were isolated from PBMCs using human CD4 microbeads (Miltenyi Biotec GmbH, Bergisch Gladbach, Germany) as previously described (33 (link)). Human PBMCs and CD4⁺ T cells were cultured with RPMI-1640 medium (Gibco, California, USA) containing 10% foetal bovine serum (Gibco) for transfection. HEK293T cells were maintained in Dulbecco’s modified Eagle’s medium (Gibco) supplemented with 10% foetal bovine serum (Gibco) at 37 °C in 5% CO₂.

Peng H., Xing J., Wang X., Ding X., Tang X., Zou J., Wang S, & Liu Y. (2022). Circular RNA circNUP214 Modulates the T Helper 17 Cell Response in Patients With Rheumatoid Arthritis. Frontiers in Immunology, 13, 885896.

+ Open protocol

+ Expand

CD4+ Cell Isolation and Enumeration

Check if the same lab product or an alternative is used in the 5 most similar protocols

CD4 depletion was performed using human CD4 MicroBeads (Miltenyi Biotec, cat. no. 130-045-101; >99% depletion efficiency) according to manufacturer’s instructions. Magnetic separation was performed using the autoMACS Pro Separator (Miltenyi Biotec). Purity of the isolated subsets was checked using flow cytometry after staining with a cocktail of antibodies containing CD14 PE-Vio770 (Miltenyi Biotec, cat. no. 130-098-074), CD3 APC (BioLegend, cat. no. 3004399) and CD4 FITC (Miltenyi Biotec, cat. no 130-114-722). Absolute number of CD14⁺ cells used for subsequent incubations was determined using BD Trucount Tubes (BD, cat. no. 340334) and no-wash staining procedure with the above antibody cocktail.

Simon T., Kirk J., Dolezalova N., Guyot M., Panzolini C., Bondue A., Lavergne J., Hugues S., Hypolite N., Saeb-Parsy K., Perkins J., Macia E., Sridhar A., Vervoordeldonk M.J., Glaichenhaus N., Donegá M, & Blancou P. (2023). The cholinergic anti-inflammatory pathway inhibits inflammation without lymphocyte relay. Frontiers in Neuroscience, 17, 1125492.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!