Total protein was extracted by the RIPA (Beyotime, Shanghai, China), separated by 8–12% SDS-PAGE and electro transferred onto a PVDF membrane (Millipore, Bedford, MA, USA). The membrane was blocked with 5% skim milk for 1 h at room temperature and incubated with primary antibodies Bax, Bcl-2, Keap1, Nrf2, ZO-1, E-cadherin (1:1000 dilution) overnight at 4 ℃, followed by HRP-conjugated secondary antibodies for additional 1 h at 37 ℃. Proteins were visualized with BIO-RAD Molecular Imager (Version 6.0, USA) using enhanced chemiluminescence reagents.
Molecular imager
Manufactured by Bio-Rad
Sourced in United States, Germany, China
The Molecular Imager is a versatile imaging system designed for a wide range of nucleic acid and protein detection applications. It captures high-quality digital images of stained gels, blots, and other samples using a variety of detection methods, including chemiluminescence, fluorescence, and visible light. The system provides accurate and reliable results, making it a valuable tool for researchers in the fields of molecular biology, biochemistry, and genetic analysis.
Automatically generated - may contain errors
Lab products found in correlation
Quantity one software, by Bio-Rad (10 mentions)
Bca protein assay kit, by Beyotime (8 mentions)
Pvdf membrane, by Merck Group (7 mentions)
Polyvinylidene fluoride membrane, by Merck Group (5 mentions)
Image lab software, by Bio-Rad (4 mentions)
Radioimmunoprecipitation assay (ripa), by Beyotime (3 mentions)
Halt protease and phosphatase inhibitor cocktail, by Thermo Fisher Scientific (3 mentions)
Y0750, by Merck Group (3 mentions)
Y2146, by Merck Group (3 mentions)
Enhanced chemiluminescence detection kit, by Thermo Fisher Scientific (3 mentions)
Quantity one 4, by Bio-Rad (3 mentions)
Trizol, by Thermo Fisher Scientific (2 mentions)
Riboquant in vitro transcription kit, by BD (2 mentions)
Enhanced chemiluminescence reagent, by PerkinElmer (2 mentions)
Quantity one, by Bio-Rad (2 mentions)
Ripa lysis buffer, by Beyotime (2 mentions)
Gradient gel, by Bio-Rad (2 mentions)
Supersignal west pico plus reagent, by Thermo Fisher Scientific (2 mentions)
Ripa buffer, by Thermo Fisher Scientific (2 mentions)
Pre stained ladder, by Bio-Rad (2 mentions)
127 protocols using molecular imager
1
Western Blot Analysis of Apoptosis and Oxidative Stress Markers
2
Quantifying NF-κB Phosphorylation in Laryngeal Tissue
3
SDS-PAGE Analysis of scuPA and sctPA
4
Protein Extraction and Western Blot Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Tissue lysates were prepared with RIPA buffer (30 mM HEPES [PH 8.0], 150 mM NaCl, 1% NP‐40, 10 mM NaF, 1 mM EDTA) containing protease inhibitors cocktail (Bytotime), and insoluble debris was removed by centrifugation at ‐12,000 g for 10 min at 4°C. The protein concentration of the supernatant was determined using the Bradford method.
Western blotting was performed as described previously.17 Protein fractions were separated by 10% or 12% SDS‐PAGE and transferred onto nitrocellulose membranes. After blocking with 5% bovine serum albumin in 0.1% (v/v) Tween‐20 in tris‐buffered saline (TBS), membranes were sequentially incubated with primary antibodies (Table 3 ) and HRP‐conjugated secondary antibodies. Protein bands were developed with enhanced chemiluminescence (ECL) substrate solution (Beyotime) and visualized using a BIO‐RAD Molecular Imager (Bio‐Rad laboratories Inc).
Co‐immunoprecipitation (Co‐IP) was performed as previously described.27 Briefly, 300–500 μl of tissue lysates was incubated with 0.5–2 μg of the corresponding antibodies (Table 3 ) for 3 h at 4 °C. 50 μl of Protein G‐agarose beads (Beyotime) was then added and incubated overnight. After washing, samples were boiled for 3–5 min in sample‐loading buffer, then subjected to SDS‐PAGE and Western blotting as described above.
Western blotting was performed as described previously.
Co‐immunoprecipitation (Co‐IP) was performed as previously described.
5
Western Blot Analysis of MyD88 and TLR4
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cell lysates were clarified by centrifugation at 12,000 revolutions per minute. Equal amounts of proteins were separated by SDS-PAGE and transferred onto polyvinylidene difluoride (PVDF) membranes. The immunoblots were probed according to standard protocols with antibodies against MyD88 (Cell Signaling Technology, Boston, USA) and TLR4 (Abcam, Cambridge, USA). The quality of the loading and transfer was assessed by immunostaining with a β-actin antibody (Protein Tech Group, LA, USA). The immunoblots were developed using enhanced chemiluminescence reagent (Millipore, Massachusetts, USA), and images were captured using a Bio-Rad Molecular imager (Bio-Rad, California, USA). The expression intensity of the immunoblots was measured using Image Measure software.
6
Apoptotic Marker Analysis of Cisplatin and Pioglitazone
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The cells were treated with either a control vehicle, 40 μM cisplatin, or combinations of cisplatin and pioglitazone (Cis 40 μM + Pio 30 μM) or (Cis 40 μM + Pio 60 μM). Following this, the cellular lysates were analyzed by immunoblotting to explore variations in the levels of various apoptotic markers. In brief, the cells were lysed using radioimmunoprecipitation assay (RIPA) Lysis Buffer (Thermo Fisher Scientific, Massachusetts USA) supplemented with protease inhibitors. Subsequently, the proteins were separated via sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and transferred onto polyvinylidene difluoride (PVDF) membranes (Sigma-Aldrich, Massachusetts, USA). The membranes were then obstructed with 5 % non-fat milk for 2 h. Following this, the membranes were exposed to primary antibodies targeting cleaved PARP (sc-56196), caspase-9 (sc-56076), and Bcl-2 (sc-7382), which were sourced from Santa Cruz (Santa Cruz, Texas, USA), and incubated overnight at 4 °C. After rinsing with buffer, the membranes were incubated for 1 h with a secondary antibody linked to horseradish peroxidase at room temperature. Protein bands were visualized using ECL reagent (Sigma-Aldrich, Massachusetts, USA) with the BioRad Molecular Imager (BioRad, California USA). Expression of GAPDH, a housekeeping gene, served as a loading control.
7
Gel Shift Assay for SRF Binding
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Gel mobility shift assays were performed as previously described [19 (link)]. Briefly, double-stranded synthetic oligonucleotides containing serum response factor (SRF) binding elements (5’- ACAGGATGTCCATATTAGGACATCT -3’) of rat c-fos promoter [26 (link)] were labelled with α-32P-dCTP. Nonspecific competitor DNAs included double-stranded oligonucleotides containing mutated sites for SRF (5’- ACAGGATGTCCATATTATTACATCT -3’). Binding reactions consisted of 10 μg of nuclear protein extract. Supershift experiments were performed by preincubating the protein extract with 4 μg of SRF antibody (Santa Cruz) for 10 minutes on ice before the binding reaction. The binding reactions were carried out at room temperature for 20 minutes. Protein-DNA complexes were separated by electrophoresis on 5% polyacrylamide gel in 0.5 × TBE (Tris-borate-EDTA buffer). The gels were dried and exposed with PhosphoImager screens (Molecular Dynamics), which were scanned by a Biorad Molecular Imager (Bio-Rad Laboratories). The results were quantified by using Quantity One software (Bio-Rad Laboratories).
8
Protein Expression Analysis in Mice Skin
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The total protein was extracted from the mice back skin with protein extract kit (Beyotime, Shanghai, China) according to the instructions. The protein quantification was performed using BCA protein assay kit (Beyotime, Shanghai, China). The samples (40 μg per sample) were separated by polyacrylamide gel electrophoresis. Subsequently, the protein was transferred to polyvinylidene fluoride membrane and blocked with 5% skim milk. The protein band was determined with Bio-Rad Molecular Imager (Bio-rad, Hercules, CA, USA) after the incubation of the first antibody Collagen I and GAPDH (Cloud-Clone Corp, China) and the secondary antibody: anti-rabbit IgG (Cloud-Clone Corp, China). Protein expression was quantified by Image J software (NIH, Bethesda, MD, USA).
9
Peptide-Induced Protein Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cells (1×105 cells) were seeded in 24-well microplates and incubated at 5% CO2, 37°C for 24 h. Cells were then treated with 425.9 ng protein/ml of the partially purified peptides and incubated in the presence of 5% CO2, 37°C for 5 days. Protein extraction was performed using passive lysis buffer (PLB) (Promega), and the protein concentration was determined using a Bradford assay. For the immunoblotting step, the protein was firstly separated using NuPAGE® Bis-Tris gel (Invitrogen; Thermo Fisher Scientific, Inc.) and transferred on to PVDF membrane (Merck Millipore). Then, the membrane was blocked with 5% skimmed milk in TBS-T for 1 h. Next, the membrane was washed with TBS-T buffer and then incubated overnight using primary antibodies that were diluted in 0.01% BSA in TBS-T. The dilution ratios for anti-p53 (Invitrogen; Thermo Fisher Scientific, Inc.), anti-RelA (p65), anti-Cyclin D1 (Santa Cruz Biotechnology) were equal to 1:1,000 (v/v); for anti-alpha-tubulin (Invitrogen; Thermo Fisher Scientific, Inc.) was equal to 1:1,500 (v/v); and anti-Ser15P was equal to 1:300 (Abcam). The membrane was then washed and incubated with horseradish peroxidase-conjugated secondary antibodies (Abcam) for 1 h. Finally, the ECL substrate (GE Healthcare) was added onto a membrane and analyzed using a molecular imager (Bio-Rad Technologies).
10
Exosomal Protein Characterization by Western Blot
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
After isolation, we lysed the exosomes in lithium dodecyl sulphate buffer (LDS buffer) and measured the protein concentration by BCA protein assay kit. Later, protein extracts were separated on SDS-PAGE, transferred to a PVDF membrane, and blocked with 5% milk in PBS and incubated overnight at 4°C with primary antibodies for CD9 (Abcam; EPR2949, 1:2000), CD63 (Santa Cruz Biotechnology; MX-49.129.5, 1:200), and HSP70 (Santa Cruz Biotechnology; sc-137210, 1:200). After washing, the membranes were incubated with the horseradish peroxidase-conjugated secondary antibody (Nanjing Jiancheng, 1:1000) for 1 h and washed again. Lastly, membranes were developed and images were collected on Bio-Rad Molecular Imager.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!