High capacity rna cdna kit

Manufactured by Thermo Fisher Scientific

Sourced in United States, France

The High-capacity RNA-cDNA kit is a reagent kit designed for the conversion of RNA to complementary DNA (cDNA) for use in various downstream applications. The kit provides components necessary for the reverse transcription reaction, enabling efficient conversion of RNA to cDNA.

Automatically generated - may contain errors

Lab products found in correlation

39 protocols using high capacity rna cdna kit

Gene Expression Analysis of Adipose Tissue Depots

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cellular RNA from freshly excised PVAT (thoracic and abdominal), WAT (renal and gonadal) and BAT (inter-scapular) was stabilized and protected using RNAlater® solution (ThermoFisher Scientific, AM7020). Tissues were homogenized individually. RNA was isolated using chloroform and isopropanol. A high capacity RNA-cDNA kit (Applied Biosystems, 4387406) was used to convert the RNA into cDNA. Samples were heated on a thermocycler (Applied Biosystems) at 37°C for 60mins before heating to 95°C to stop the reaction. The 96 well Fast SYBR Green (Life Technologies, 4472908) Δ-ΔCᴛ qPCR method (ViiA7 qPCR machine; Applied Biosystems) was used to quantify gene expression. The following primers were used: Asc-1 (FP: ACAGGCCAGGATCTAAGGTG, RP: CCTCGTGGGGTCTCAACATA), PAT2 (FP: CCTTCCTGAGAGTGCCAAGA, RP: TGTCTGGAACCCGGTTATGC), galectin-3 (FP: ACCCAACGCAAACAGGATTG, RP: TGTCCTGCTTCGTGTTACAC), iNOS (FP: TATTTTCAGGGCTTGCGTGG, RP: CCACCTCTCCTGGCTTGATG), CD11c (FP: ACGCTTACCTGGGTTACTCC, RP: AAGATGACAACCTTCCCCGT), Arg1 (FP: ACAAGACAGGGCTCCTTTCA, RP: TGCCGTGTTCACAGTACTCT) and CD206 (FP: GTTCAGCTATTGGACGCGAG, RP: AGTTGCCGTCTGAACTGAGA). The normalization control was β-actin (FP: TGGCACCACACCTTCTACAA, RP: AGGTCTCAAACATGATCTGGGT). Results were presented as the average change in expression (CIA vs. naïve) in DBA/1 wild-type mice.

Sime K., Choy E.H, & Williams A.S. (2017). Alterations to adipose tissue morphology during inflammatory arthritis is indicative of vasculopathology in DBA/1 mice. Adipocyte, 6(2), 87-101.

+ Open protocol

+ Expand

RNA Extraction and qPCR Analysis of Brain Tissues

Check if the same lab product or an alternative is used in the 5 most similar protocols

For the isolation of RNA, brain tissues were homogenized in TRIzol (Invitrogen). Chloroform was added (1:5 ratio), samples were vigorously shaken for 15 seconds at room temperature, and then centrifuged at 12,000 × g for 15 minutes at 4°C. The aqueous phase of the sample was removed by angling the tube at 45° and pipetting the solution out. Then samples were diluted (1:1) in 100% isopropanol and incubated for 10 minutes at room temperature. Samples were centrifuged at 12,000 × g for 10 minutes at 4°C. The pellet was washed in 75% ethanol, and then centrifuged at 7500 × g for 10 minutes. Supernatant was discarded and the RNA pellet air-dried for 10 minutes before resuspension in RNase-free water. Reverse transcription was performed by using a high-capacity RNA-cDNA kit (Applied Biosystems [ABI]). Quantitative PCR was performed using an ABI TaqMan primer targeting human MAPT (Product no: Hs00902194_m1, Life Technologies) and reagents on an ABI Prizm 7500 thermocycler according to the manufacturer’s instructions. All mRNA measurements were normalized to the total cDNA

Yanamandra K., Patel T.K., Jiang H., Schindler S., Ulrich J.D., Boxer A.L., Miller B.L., Kerwin D.R., Gallardo G., Stewart F., Finn M.B., Cairns N.J., Verghese P.B., Fogelman I., West T., Braunstein J., Robinson G., Keyser J., Roh J., Knapik S.S., Hu Y, & Holtzman D.M. (2017). Anti-tau antibody administration increases plasma tau in transgenic mice and patients with tauopathy. Science translational medicine, 9(386), eaal2029.

+ Open protocol

+ Expand

Quantifying Connexin Expression in Pituitary Adenomas

Check if the same lab product or an alternative is used in the 5 most similar protocols

The synthesis of cDNA was performed from 1 µg of total RNA from each sample using the High Capacity RNA-cDNA kit (Applied Biosystems, Waltham, MA, USA) in a final volume of 20 µL, following the manufacturer’s instructions. The reaction was performed using a Veriti 96-well thermal cycler. mRNA expression of Cx26, 32, and 43 were evaluated in the PitNETs adenomas and a pool of four normal human anterior pituitary samples. Quantitative reverse transcriptase-polymerase chain reaction (qRT-PCR) was performed using the Power SYBR Green PCR Master mix (Applied Biosystems, USA) and each sample was run in triplicate. The thermal cycling conditions consisted of one cycle at 50 °C for 2 min, and 95 °C for 10 min, followed by 40 cycles at 95 °C for 15 s, and 60 °C for 1 min. All the samples were normalized by a housekeeping gene, β-actin, and the amplification was performed using the 7500 Real-time PCR system (Applied Biosystems, USA). The relative gene expression was quantified using the 2^−ΔΔCt method and presented as the expression relative to that of the normal human anterior pituitary.

Nunes B., Pópulo H., Lopes J.M., Reis M., Nascimento G., Nascimento A.G., Fernandes J., Faria M., de Carvalho D.P., Soares P, & Miranda-Alves L. (2022). Connexin Expression in Pituitary Adenomas and the Effects of Overexpression of Connexin 43 in Pituitary Tumor Cell Lines. Genes, 13(4), 674.

+ Open protocol

+ Expand

Quantifying Plk1 mRNA Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

mRNA was extracted from oocytes using the RNeasy Micro Kit (Qiagen) and cDNA was generated using the High-Capacity RNA-cDNA Kit (Applied Biosystems). Real-time PCR was performed with the 7900HT Fast Real-Time PCR System (Applied Biosystems) using SYBR green. Gapdh mRNA was used for normalization. The following primer sets were used: Gapdh, forward 5′- AGAGCTGAACGGGAAGCTCACT -3′, reverse 5′- TGCCTGCTTCACCACCTTCTTGAT -3′; Plk1, forward 5′- TGTAGTTTTGGAGCTCTGTCG -3′, reverse 5′- TCCCTGTGAATGACCTGATTG -3′.

Clift D, & Schuh M. (2015). A three-step MTOC fragmentation mechanism facilitates bipolar spindle assembly in mouse oocytes. Nature Communications, 6, 7217.

+ Open protocol

+ Expand

RNA Analysis of HLF Cell Lysates

Check if the same lab product or an alternative is used in the 5 most similar protocols

For RNA analysis of HLF lysates, cell pellets were dissolved in RNeasy lysis buffer (Qiagen, Germantown, MD, United States). RNA was isolated and quantified as above, and 1 μg of RNA was reverse transcribed by use of the High Capacity RNA-cDNA kit (Applied Biosystems, Waltham, MA, United States). qPCR was performed at 1/4 dilution with fast SYBR Green Master Mix (Applied Biosystems, Waltham, MA, United States) for human COLI (collagen I) and COLIII (collagen III) genes. GAPDH was used as the housekeeping gene and expression was constant. qPCR was done on a Step One real- time PCR system (Applied Biosystems, Waltham, MA, United States). Human primer sequences are listed in Table 1.

Savage A., Risquez C., Gomi K., Schreiner R., Borczuk A.C., Worgall S, & Silver R.B. (2023). The mast cell exosome-fibroblast connection: A novel pro-fibrotic pathway. Frontiers in Medicine, 10, 1139397.

+ Open protocol

+ Expand

Quantitative Analysis of Plk1 mRNA

Check if the same lab product or an alternative is used in the 5 most similar protocols

mRNA was extracted from oocytes using the RNeasy Micro Kit (Qiagen) and cDNA was generated using the High-Capacity RNA-cDNA Kit (Applied Biosystems). Real-time PCR was performed with the 7900HT Fast Real-Time PCR System (Applied Biosystems) using SYBR green. Gapdh mRNA was used for normalization. The following primer sets were used: Gapdh, forward 5′-AGAGCTGAACGGGAAGCTCACT-3′, reverse 5′-TGCCTGCTTCACCACCTTCTTGAT-3′; Plk1, forward 5′-TGTAGTTTTGGAGCTCTGTCG-3′, reverse 5′-TCCCTGTGAATGACCTGATTG-3′.

Clift D, & Schuh M. (2015). A three-step MTOC fragmentation mechanism facilitates bipolar spindle assembly in mouse oocytes. Nature Communications, 6, 7217.

+ Open protocol

+ Expand

Quantifying Intracellular Viral RNA

Check if the same lab product or an alternative is used in the 5 most similar protocols

To determine the intracellular viral RNA, we extracted the total RNA from ~6 × 10⁶ to 8 × 10⁶ GFP-EBV- or GFP-KSHV-infected Sh-Sy5y cells, NT-2 neurons, primary human neurons, or PBMCs at the specified time points postinfection with the TRIzol reagent (Invitrogen Inc., Carlsbad, CA) as described earlier (72 (link)). A 1.0-µg sample of DNase-treated total RNA was used to synthesize cDNA with the high-capacity RNA-cDNA kit (Applied Biosystems Inc., Foster City, CA) according to the manufacturer’s instructions. The specific target gene for amplification are shown in Table 1. The target genes were amplified from cDNA with power SYBR green PCR master mix (Applied Biosystems Inc., Carlsbad, CA), 1 mM primer, and 2 µl of the cDNA product in a total volume of 10 µl. The reactions were prformed with 96-well plates at 95°C for 10 min, followed by 36 cycles of 95°C for 30 s, 56°C for 30 s, and 72°C for 30 s and then 10 min at 72°C. Melting curve analysis was performed to verify the specificity of the amplified products. The relative quantitation values were calculated by the ΔΔC_T method. All reactions were run in triplicate. GAPDH was used as the endogenous control.

Jha H.C., Mehta D., Lu J., El-Naccache D., Shukla S.K., Kovacsics C., Kolson D, & Robertson E.S. (2015). Gammaherpesvirus Infection of Human Neuronal Cells. mBio, 6(6), e01844-15.

+ Open protocol

+ Expand

Quantitative Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was extracted from cells using a Qiagen RNEasy Plus Kit and quantified on a Nanodrop spectrophotometer. Equal quantities of RNA (2 μg) were then reverse transcribed using an Applied Biosystems High Capacity RNA- cDNA kit as per the manufacturer’s instructions. Resulting cDNAs were diluted as needed to carry out 10 μl Taqman reactions in triplicate using an Applied Biosystems Taqman Gene Expression Master Mix and Applied Biosystems 7900HT Thermal cycler using the manufacturer’s recommended conditions and analysed, which were subsequently analysed using Applied Biosystems SDS 2.4 software to calculate respective Δct values and relative gene expression levels. Taqman probes used were GAPDH; Hs02758991_g1, EBLN1; Hs00908304_s1 and TPR; Hs00162918_m1.

Myers K.N., Barone G., Ganesh A., Staples C.J., Howard A.E., Beveridge R.D., Maslen S., Skehel J.M, & Collis S.J. (2016). The bornavirus-derived human protein EBLN1 promotes efficient cell cycle transit, microtubule organisation and genome stability. Scientific Reports, 6, 35548.

+ Open protocol

+ Expand

Reverse Transcription-PCR for Rluc

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated from completed in vitro translation reactions using an RNeasy mini-kit (Qiagen). cDNA was generated using a high capacity RNA-cDNA kit (Applied Biosystems) according to the manufacturer’s instructions, and used as a template for PCR. Primers used were: Rluc F 5′-ACGGATGATAACTGGTCCGC-3′ and Rluc R 5′-TAATACACCGCGCTACTGGC-3′. PCR reactions were run on a 1.8% TBE-agarose gel containing ethidium bromide alongside 100 bp DNA ladder (NEB) and visualised under UV light using a Gel Doc XR (BioRad).

Ray S, & Anderson E.C. (2016). Stimulation of translation by human Unr requires cold shock domains 2 and 4, and correlates with poly(A) binding protein interaction. Scientific Reports, 6, 22461.

+ Open protocol

+ Expand

Quantifying mRNA Expression via qRT-PCR

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

For the quantification of mRNA, complementary cDNA was generated using the high capacity RNA-cDNA kit (Applied Biosystems, Foster City, CA, USA), according to the manufacturer’s instructions. A quantity of 1 µg total RNA isolated HSCs was used to generate cDNA. The mRNA levels were measured using qRT-PCR with master mix (Fast qPCR SyGreen Blue Mix, PCR Biosynthesis, Wayne, PA, USA). The PCR reaction steps were performed as previously described [19 (link)]. The 2^(−ΔΔCT) method was used to determine the relative amounts of mRNA, using GAPDH as the reference gene. For primers list, see online Supplementary Data (Figure S2).

Reif S., Atias A., Musseri M., Koroukhov N, & Gerstl R.G. (2022). Beneficial Effects of Milk-Derived Extracellular Vesicles on Liver Fibrosis Progression by Inhibiting Hepatic Stellate Cell Activation. Nutrients, 14(19), 4049.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!