Faststart universal sybr green master with rox

The expression of the specified target genes was quantified by q-RT-PCR, using Fast Start Universal SYBR Green Master with ROX (Roche), and was normalized to the expression of β-actin and normal samples. Custom designed primers were used.

RNA extraction and quantitative real-time polymerase chain reaction (qRT-PCR). RNA extraction of brain subregion samples was conducted with RNeasy Mini Kit (Qiagen) with on column DNase digestion (Qiagen), based on the manufacturer’s protocol. The RNA concentration and quality were measured by NanoDrop 1000 (Thermo Scientific, Waltham, MA, USA). Total 0.6 μg RNA from each sample was reverse transcribed in 20 μl total volume using the iScript cDNA synthesis kit (Bio-Rad).
Gene expression of brain subregions was measured using FastStart Universal SYBR Green Master with Rox (Roche) and analyzed using ABI 7500 RT PCR System (Life Technologies, Carlsbad, CA, USA). Gene expression was normalized to gapdh mRNA. Data are presented as fold-change in gene expression in each group relative to control group. The primers of Asic1a, Asic1b, Asic2a, Asic2b, and Asic4 were adapted from previous study (Schuhmacher and Smith, 2016 (link)). Asic3 primers were designed based on Primer-BLAST (NCBI, NIH). The primer sequence for Asic3 were forward, 5′-TATGTGGCTCGGAAGTGCGGAT-3′, and reverse, 5′-CAGACACAAGTGTCCTTTCGCAG-3′.

mRNA transcripts were purified from cells using a RNAeasy kit (Qiagen) and subsequently reverse transcribed using a High Capacity cDNA reverse transcription kit (Applied Biosystems). PPM1D and NAPRT gene expression levels were assessed through qPCR with TaqMan fluorescent probes (all from Applied Biosystems): PPM1D (4331182), NAPRT (4351372), and Actin (4333762F), according to manufacturer’s protocol. Expression level fold change was calculated via ΔΔCt comparison, using Actin as a reference gene. The NAPRT promoter region was quantitated via qPCR using Fast Start Universal SYBR Green Master with ROX (Roche), and primers listed in Supplementary Table 2. All qPCR reactions were run on a StepOnePlus Real Time PCR system (Applied Biosystems).

Homogenized mouse spinal cords (L4-spine level) or primary microglia culture were lysed with 1 ml TRIzol Reagent (Invitrogen). Nucleoprotein complexes were then separated through bromochloropropane (Sigma-Aldrich), and the samples were centrifuged at 12,000 rpm at 4˚C for 15 min. Total RNA was precipitated with an equal volume of isopropanol. The samples were incubated at 25˚C for 10 min and centrifuged at 12,000 rpm at 4˚C for 15 min. The RNA pellets were collected and washed with ethanol by vigorous mixing. RNA was obtained by centrifugation at 7,500 rpm at 4˚C for 10 min. After air-drying, the RNA pellets were dissolved in RNase-free double-distilled water. Reverse transcription was performed using a Reverse Transcription Kit (Applied Biosystems) to synthesize cDNA. Quantitative real-time PCR (qPCR) was performed using FastStart Universal SYBR Green Master with ROX (Roche), and cDNA was amplified using a StepOnePlus RealTime PCR System (Applied Biosystems). PCR cycling conditions were set as follows: 95°C for 10 min, then 40 cycles of 95°C for 15 s, 60°C for 1 min, and 72°C for 20 s. The specificity of the SYBR green assay was confirmed by melting-point analysis. Expression data was calculated from the cycle threshold (Ct) value using the ΔCt method for quantification. Primer sequences are listed in Supplementary Table 1.

RNA was independently extracted from cells grown under the same growth condition as described previously for transcriptomic (RNA-seq) analysis. First-strand cDNAs were synthesized using SuperScript II Reverse Transcriptase (Invitrogen) with gene-specific P2 primers (Table S1). qPCR was performed following multiplex reverse transcription using FastStart Universal SYBR Green Master with ROX (Roche) using five fivefold serial dilutions of each cDNA sample to determine PCR efficiency and favourable dilution factor. The manufacturer’s protocol was modified for 20 µl reactions. Four technical replicates per duplicate or triplicate biological replicates were subjected to qPCR. The gene-specific primer sets used for qPCR are listed in Table S1 (available in the online version of this article).

RNA extraction and cDNA synthesis were performed as described previously [21 (link)]. Quantitative PCR was performed with FastStart Universal SYBR Green Master with Rox (Roche) on a 7500 FAST (Applied Biosystems). Each PCR assay was run in triplicate for checking PCR variations. Expression levels of the target genes were normalized to that of hypoxanthine guanine phosphoribosyl transferase (Hprt). The primers used were: human LSF, tggcttcaacagttcccata and tctggctggtggtttggt; mouse Lsf, cccctccagtcacggataa and gcctcgtgaatgtggagaac; human HPRT, tgacactggcaaaacaatgca and ggtccttttcaccagcaagct; mouse Hprt, tcctcctcagaccgctttt and cctggttcatcatcgctaatc; human p21^CIP1, ggcagaccagcatgacagatt and gcggattagggcttcctctt; mouse p21^CIP1, gaacatctcagggccgaaaa and ctcccgtgggcacttcag.