The experiments were performed as previously described [22 (link)] Total RNA was isolated from melanoma cells utilizing TRIzol (Invitrogen) following the user's manual. The complementary DNA (cDNA) was obtained by applying the reverse transcription kit (TaKaRa, Shanghai, China) as per the supplier's guideline. Subsequently, PCR amplification was completed via the SYBR-Green PCR system (TaKaRa). GAPDH functioned as internal control. Expression fold-change of LINC00518, MITF, and EIF4A3 was calculated following the 2−ΔΔCt method.
Sybr green pcr system
Manufactured by Takara Bio
Sourced in Japan
The SYBR Green PCR system is a real-time PCR solution that utilizes the SYBR Green dye to detect and quantify target DNA sequences. The system provides a rapid and sensitive method for gene expression analysis, DNA quantification, and other real-time PCR applications.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (5 mentions)
Revertra ace kit, by Toyobo (3 mentions)
Reverse transcription kit, by Takara Bio (2 mentions)
Trizol reagent, by Sangon (2 mentions)
Trizol, by Thermo Fisher Scientific (1 mentions)
Abi 7500 thermal cycler, by Thermo Fisher Scientific (1 mentions)
Primescript 2 1st strand cdna synthesis kit, by Takara Bio (1 mentions)
Chip it express kit, by Active Motif (1 mentions)
Handy sonic ur 20p, by TOMY (1 mentions)
Superscript 3 first strand synthesis kit, by Thermo Fisher Scientific (1 mentions)
Mirna reverse transcription kit, by Takara Bio (1 mentions)
Primescript rt reagent kit, by Takara Bio (1 mentions)
Nanodrop 5500, by Thermo Fisher Scientific (1 mentions)
High capacity cdna reverse transcription kit, by Takara Bio (1 mentions)
Rneasy mini kit, by Qiagen (1 mentions)
Primescript rt master mix, by Takara Bio (1 mentions)
Taqman pcr system, by Thermo Fisher Scientific (1 mentions)
10 protocols using sybr green pcr system
1
Quantitative Gene Expression Analysis
2
Quantitative Analysis of Multidrug Resistance in HepG2 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from the cells (HepG2 or HepG2/5-FU) with TRIzol® reagent (Sangon Biotech Co., Ltd.,), and cDNA synthesis was performed using the PrimeScript II 1st Strand cDNA Synthesis kit (Takara Bio, Inc.) according to the manufacturer's instructions. QPCR was performed with a SYBR® Green PCR system (Takara Bio, Inc.) in an ABI 7500 thermal cycler (Thermo Fisher Scientific, Inc.), and the thermocycling conditions were as follows: 94°C for 5 min; followed by 35 cycles of 94°C for 30 sec, 58°C for 30 sec and 72°C for 15 sec. The primers used were as follows: GAPDH forward, 5′-GCAGTGGCAAAGTGGAGATT-3′ and reverse, 5′-TGAAGTCGCAGGAGACAACC-3′; MDR1 forward, 5′-TCACTTCAGTTACCCATCTCG-3′ and reverse, 5′-CACCAATGATTTCCCGTAG-3′; P-gp forward, 5′-ACTTGCAAGGGGACCAGAGA-3′ and reverse, 5′-CCTTCAAGATCCATTCCGACC-3′; cyclin A forward, 5′-TCCATGTCAGTGCTGAGAGGC-3′ and reverse, 5′-GAAGGTCCATGAGACAAGGC-3′; cyclin B1 forward, 5′-ATGCAGCACCTGGCTAAGAA-3′ and reverse, 5′-TTACACCTTTGCCACAGCCT-3′; CDK2 forward, 5′-CTTTGCTGAGATGGTGACTCG-3′ and reverse, 5′-TCATCCAGGGGAGGTACAACT-3′; and caspase-3 forward, 5′-TGCATACTCCACAGCACCTG-3′ and reverse, 5′-TCTGTTGCCACCTTTCGGTT-3′. RT-qPCR for each sample was performed in duplicate. The fold-changes were calculated by relative quantification (2−ΔΔCq) (21 (link)). GAPDH was used as an internal control.
3
ChIP-qPCR for POU5F1 Binding Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The cells were cross-linked with formaldehyde in PBS (final concentration is 1%) for 10 min. The reaction was stopped by glycin (final concentration 125 mM). The cells were lysed in Lysis buffer 3 (10 mM Tris-HCl, pH8.0, 100 mM NaCl, 1 mM EDTA, 0.5 mM EGTA, 0.1% Na-deoxycholate, 0.5% N-lauroylsarcosine) containing proteinase inhibitor cocktail. Sonication was conducted with the Handy Sonic UR-20P (Tomy) to generate DNA fragments of approximately 150–450 bp. The sheared chromatin was precipitated with 3 μg of anti-POU5F1 antibodies or anti-HA antibodies using the ChIP-IT Express kit (Active motif), according to the manufacturer’s instructions. The purified DNA was subject to Real-time PCR with the SYBR Green PCR system (Takara). Primer sequences are listed in Supplementary Table S5 .
4
RNA Isolation and Real-time PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated with TRIzol reagent (Invitrogen), and cDNAs were generated with random hexamers using the Superscript III First-strand Synthesis Kit (Invitrogen) or the ReverTra Ace kit (Toyobo). Real-time PCR was performed using a SYBR Green PCR system (Takara). The primer sequences used for RT-PCR are listed in Table S6 .
5
Quantitative Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from tissues and cells using TRIzol reagent (Invitrogen, CA, USA) as per manufacturer’s instructions. cDNA synthesis was performed by using a reverse transcription kit (TaKaRa, ShangHai, China) according to the manufacturer’s protocols. The PCR amplification was performed with specific primers and carried out using the SYBR-Green PCR system (Takara Bio, Inc). GAPDH or β-actin served as internal control. Calculation of the relative expression of each gene was quantified by the 2−ΔΔCt method.
6
Transcriptome Analysis by RT-qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated with TRIzol reagent (Invitrogen), and cDNAs were generated with random hexamers using the ReverTra Ace kit (Toyobo). Real-time PCR was performed using a SYBR Green PCR system (Takara). The primer sequences used for RT-PCR are listed in Supplementary Table S5 .
7
Quantitative Analysis of miR-124 and BIRC3
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using TRIzol Reagent (Invitrogen, USA) as per manufacturer's instructions. cDNA was synthesized from reverse transcription with RNA through miRNA reverse transcription kit (TaKaRa, ShangHai, China). The PCR amplification for the quantification was performed with specific primers and carried out using the SYBR-Green PCR system (Takara Bio, Inc.). PCR reaction procedure was 40 cycles of 95 °C 5 s, 60 °C 30 s, 94 °C 90 s. The primer sequences for the miR-124 and U6, BIRC3 and β-actin were listed in Table 2 . The data were normalized using the U6 and β-actin transcripts for miRNA and genes, respectively. The relative expression of each gene was quantified by the 2-ΔΔCt method. Each reaction was performed in triplicate.
8
Quantifying NOX4 and α-SMA mRNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from cultured HBSMCs. Reverse transcription was performed using a PrimeScript RT Reagent Kit (Takara Bio, Kyoto, Japan). The expression of NOX4, α-SMA, and GAPDH mRNAs was determined by quantitative real-time PCR reaction using the SYBR Green PCR system (Takara Bio, Kyoto, Japan). The data were normalized to that of GAPDH and expressed as fold change over the control.
9
Quantitative Analysis of Ucp1 Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was extracted using TRIzol reagent (Sangon, #B511311-0100). The RNA quality and quantity were determined using a NanoDrop 5500 (Thermo). mRNA was reverse transcribed using a High-Capacity cDNA Reverse Transcription Kit (Takara, #RR047A) according to the manufacturers’ instructions and processed for quantitative real-time PCR using the SYBR Green PCR system (Takara, #RR820A). The primers used to amplify a fragment of Ucp1 were 5’-ACTGCCACACCTCCAGTCATT-3’ and 5’- CTTTGCCTCACTCAGGATTGG-3’. Mouse β-actin was used as the endogenous control to which sample values were normalized. The sequences used to amplify a fragment of β-actin were 5’- GTGACGTTGACATCCGTAAAGA −3’ and 5’-GCCGGACTCATCGTACTCC −3’. Expression levels were calculated based on the 2−ΔΔCt method.
10
Gene Expression Analysis of Dopaminergic Neurons
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated with TRIzol reagent (Invitrogen) or RNeasy Mini Kit (Qiagen, Hilden, Germany), and cDNAs were generated with random hexamers using the PrimeScript RT Master Mix (Takara, Shiga, Japan) or the ReverTra Ace kit (Toyobo, Osaka, Japan). Real‐time PCR was performed using SYBR Green PCR system (Takara) or TaqMan PCR system (Applied Biosystems, Foster City, California). The primer sequences used were as follows: MAP2, 5′‐ccaatggattcccatacagg‐3′ and 5′‐tctccgttgatcccattctc‐3′, tyrosine hydroxylase (TH), 5′‐ccgtgctaaacctgctcttc‐3′ and 5′‐atggtggattttggcttcaa‐3′, DAT, 5′‐ttcatcatctacccggaagc‐3′ and 5′‐ggtgagcagcatgatgaaga‐3′, EN1, 5′‐aagccacaggcatcaagaac‐3′ and 5′‐ctcgctctcgtctttgtcct‐3′, GIRK2, 5′‐tagaggacccctcctggact‐3′ and 5′‐atctgtgatgacccggtagc‐3′, AADC, 5′‐gagctgggttaattggtgga‐3′ and 5′‐gtctctctccagggcttcct‐3′.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!