Sensifast sybr lo rox mix

RNA was extracted using Isolate II Mini kit (Bioline), following manufacturer’s instructions. cDNA was generated using SensiFast cDNA synthesis kit (Bioline) following manufacturer’s instructions. For qPCR reaction 1 μg of cDNA was used with SensiFast Sybr Lo-Rox mix (Bioline) and respective primer pair. All reactions were performed in triplicates and the results were analyzed using the deltadelta Ct method. The sequences of primers used are as follows:
RPL13 forward GGCCCAGCAGTACCTGTTTA, RPL13 reverse AGATGGCGGAGGTGCAG, RBM39 forward GTCGATGTTAGCTCAGTGCCTC, RBM39 reverse ACGAAGCATATCTTCAGTTATG, CCNH forward TGTTCGGTGTTTAAGCCAGCA, CCNH reverse TCCTGGGGTGATATTCCATTACT.

Total mRNA was isolated from S2 cells or Drosophila larvae by using Trizol reagent (15596026, Thermo Fisher Scientific) according to the manufacturer’s instructions. RNA was reverse-transcribed (1 µg each experimental point) by using SensiFAST cDNA Synthesis Kit (BIO-65053, Bioline) and qPCR was performed as described (Di Magno et al., 2020 (link)) using SensiFast Sybr Lo-Rox Mix (BIO-94020, Bioline). The run was performed by using the Applied Biosystems (Waltham, MA) ViiA 7 Real-Time PCR System 36 instrument.
The following primers were used:

To confirm the efficacy of gene silencing by the peptide/siRNA nanocomplexes, Jurkat and Neuro-2a cells were transfected with 200 pmole of human CD4 and murine SOD1-targeting siRNA complexed with FBP9R at the indicated molar ratio, and lipofectamine 2000 (LMN; Invitrogen, Carlsbad, CA, USA) was used as a positive control. Then, 24 h post-transfection, cells were harvested and washed with PBS twice. Total mRNA was extracted from the harvested cells using an RNAiso kit (Takara, Kyoto, Japan), reverse-transcribed with the iScript cDNA synthesis kit (Bio-Rad, Hercules, CA, USA), and quantified with SensiFAST SYBR Lo-Rox mix (Bioline, London, UK) on the ABI 7500 Fast Real-time PCR system (Applied Biosystem, Waltham, MA, USA). Human CD4 and murine SOD1 mRNA levels were quantified using the depicted primer sets and normalized to human and murine GAPDH.

To confirm the silencing efficacy of FBP9R/siRNA complexes, 2 nmole of siRNA targeting SOD1, Bax and GFP, complexed with FBP9R, was intranasally administrated as a single dose 12 h post-MCAO surgery to each cohort (n = 6 per group). Total mRNA was extracted from brain tissue using an RNAiso kit (Takara, Kyoto, Japan), reverse transcribed with the iScript cDNA synthesis kit (Bio-Rad, Hercules, CA, USA), and quantified with SensiFAST SYBR Lo-Rox mix (Bioline, London, UK) on the ABI 7500 Fast Real-Time PCR system (Applied Biosystem, Waltham, MA, USA).

For Quantitative Real-Time PCR (qPCR), young leaves from 12-week-old plants grown in greenhouse at normal ambient temperature were harvested and frozen in liquid nitrogen for further experiments. Total RNA was extracted with the E.N.Z.A. Plant RNA Kit (OMEGA Bio-tek, GA, United States) and treated with DNase I (Thermo Scientific, MA, United States). 1 μg of RNA was used for cDNA synthesis with the RevertAid first-strand cDNA synthesis kit (Thermo Scientific, MA, United States). qPCRs were performed with an Eppendorf realplex² Mastercycler (Eppendorf, Hamburg, Germany) using the SensiFAST SYBR Lo-ROX Mix (Bioline, London, United Kingdom) and the primers YFP forward (5′-AAGCAGAAGAACGGCATCAA-3′) and YFP reverse (5′-GGGGGTGTTCTGCTGGTAGT-3′), to amplify parts of YFP. Data were normalized to SlACT and samples were measured in at least three biological and four technical replicates.

After 24 h of transfection, the total RNA from HCMs subjected to a transfection protocol was extracted with the TRI Reagent^® (Sigma-Aldrich, St. Louis, MI, USA) and the Direct-zol^TM RNA MiniPrep Kit (Zymo Research, Irvine, CA, USA) according to the manufacturer’s instructions. The quantity and quality of RNA samples were assessed using a spectrophotometer (Nanodrop 2000, Thermo Fisher Scientific, Waltham, MA, USA). cDNA strands were synthesized through reverse transcription reaction using RevertAid Reverse Transcriptase, Oligo (dT) primers, RiboLock RNase Inhibitor, and dNTP (Thermo Fisher Scientific, Waltham, MA, USA). Amplification and fluorescent quantification were obtained from an ABI QuantStudio 5 Real-Time PCR System (Thermo Fisher Scientific, Waltham, MA, USA) using a SensiFAST SYBR Lo-ROX mix (BIOLINE, London, UK). RT-qPCR reactions were performed in triplicate. For normalization of the miRNA analysis, GAPDH and β-ACTIN were used as housekeeping genes. In addition, the relative quantification of target gene expression was performed using the ddCt method [22 (link)]. All primers used for amplification are listed in Table 2. Lastly, data were analyzed using GraphPad Prism version 8.0 for Mac (GraphPad Software). Statistical significance was determined using unpaired Student’s t-test. Differences were considered statistically significant when ** p < 0.01, *** p < 0.001.