Rhtpo

Manufactured by Thermo Fisher Scientific

Sourced in United States

The RhTPO is a lab equipment product manufactured by Thermo Fisher Scientific. It is designed to perform a specific core function, but a detailed description while maintaining an unbiased and factual approach is not available.

Automatically generated - may contain errors

Lab products found in correlation

21 protocols using rhtpo

Myelodysplastic Syndrome and Acute Myeloid Leukemia Transcriptome Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Informed consent was obtained according to protocols approved by the review boards of Cleveland Clinics. Diagnoses were reviewed at Cleveland Clinics and adapted, when required, to WHO 2008 criteria. For qRT-PCR analysis, bone marrow aspirates were collected from 41 patients and 15 age-matched healthy controls (Supplemental Table 1). For functional studies, MDS/AML peripheral MNCs (Supplemental Table 1) were cultured in StemSpan Serum-Free Expansion Media (SFEM, Stemcell Technologies) supplemented with 100ng/mL of recombinant human stem cell factor (rhSCF, 02830, StemCell Technologies), human Flt3 ligand (rhFL, 02840, StemCell Technologies), human thrombopoietin (rhTPO, 02522, PeproTech) for 48hours before transduction. Cells were cultured in rhSCF, rhFlt3L, rhTPO, rhIL-3, and rhIL-6 at 10ng/mL.

Fang J., Barker B., Bolanos L., Liu X., Jerez A., Makishima H., Christie S., Chen X., Rao D.S., Grimes H.L., Komurov K., Weirauch M.T., Cancelas J.A., Maciejewski J.P, & Starczynowski D.T. (2014). Myeloid malignancies with chromosome 5q deletions acquire a dependency on an intrachromosomal NF-κB gene network. Cell reports, 8(5), 1328-1338.

+ Open protocol

+ Expand

Expansion of CD34+ Cord Blood Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

Human CD34+ cells were isolated from Buffy coat samples or frozen umbilical cord blood samples by enrichment using anti-CD34 magnetic microbeads (Macs, Miltenyi). CD34+ cord blood cells were expanded in StemSpan SFEM (Stem Cell Technologies) supplemented with 100ng/ml rhFLT-3L, 100ng/ml rhSCF, 100ng/ml rhTPO and 20ng/ml IL-3 (Preprotech). rhIFNγ (1000 U/mL) was added to media for 18hrs before harvest.

Florez M.A., Matatall K.A., Jeong Y., Ortinau L., Shafer P.W., Lynch A.M., Jaksik R., Kimmel M., Park D, & King K.Y. (2020). Interferon Gamma Mediates Hematopoietic Stem Cell Activation and Niche Relocalization through BST2. Cell reports, 33(12), 108530.

+ Open protocol

+ Expand

Liquid culture and CFC assay of CD34+ cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

Liquid culture of CD34+ cells and CFC assay were previously described^{32 (link)}. Briefly, CD34+ were cultured in StemSpan or IMDM 5% fetal bovine serum medium (StemCell Technologies) in presence of rhSCF (100ng/ml), rhIL6 (20ng/ml), rhFlt3-L (100ng/ml) and rhTPO (20ng/ml) (all from Peprotech) for liquid culture, while for CFC assay were plated at 10³ cells/ml in semi-solid medium (MethoCult H4434 Classic - StemCell technologies) and scored by microscope 14 days later. Proliferation and mortality of liquid cultures were assessed at 3, 7, 11 and 14 days post-transduction. OP9-ΔL1 stromal cell line was kindly provided by I. Schmutz and M. Cavazzana and co-culture was performed as described for 21 days^{14 (link)}. In vitro proliferation of T cells was assessed by cell proliferation dye efluor670 (eBioscience) staining of total splenocytes or magnetically purified CD4+ and CD4+CD25- cells, where indicated, upon stimulation by antiCD3/CD28/CD2 beads (Treg suppression inspector beads – Miltenyi Biotec) following manufacturer’s instructions.

Santoni de Sio F.R., Passerini L., Valente M.M., Russo F., Naldini L., Roncarolo M.G, & Bacchetta R. (2017). Ectopic FOXP3 Expression Preserves Primitive Features Of Human Hematopoietic Stem Cells While Impairing Functional T Cell Differentiation. Scientific Reports, 7, 15820.

+ Open protocol

+ Expand

Ex Vivo Expansion of CD34+ Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

CD34^pos cells were cultured at 10⁵ cells/mL in Stem Span^TM SFEM II supplemented with 100 ng/mL rhSCF (Peprotech, Neuilly-sur-Seine, France), 100 ng/mL rh Flt-3L (Peprotech), 20 ng/mL rhTPO (Peprotech), and 10 ng/mL rhG-CSF (Neupogen; AMGEN, Boulogne Billancourt, France). The cells were diluted in a fresh medium at days 3 and 6 to maintain the cell concentration under 1.5 × 10⁶ cells/mL, and were analyzed at the time points specified in the Results section.

Debeissat C., Avalon M., Huart M., Duchez P., Rodriguez L., Vlaski-Lafarge M., Ivanovic Z, & Brunet de la Grange P. (2022). Alpha Lipoic-Acid Potentiates Ex Vivo Expansion of Human Steady-State Peripheral Blood Hematopoietic Primitive Cells. Biomolecules, 12(3), 431.

+ Open protocol

+ Expand

Human CD34+ Cell Culture and Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Human CD34⁺ cells were isolated as described above, and then cultured (6.4 X 10⁴ cells in each well in a 24-well-plate) in 1 ml of STEM PRO®-34 SFM medium, supplemented with 10% fetal bovine serum, 100 ng/mL Pen/ Strep, and 2 mM L-glutamine (Gibco, USA), as well as 20 ng/ml rhTPO and 100 ng/ml rhFlt3-L (Pepro Tech, USA). Additional reagents were added where indicated, including rhSCF protein (100 ng/ml) and peptides (100 ng/ml, each). Regarding to mAb addition groups, 100 ng/ml rhSCF combined with 23C8 was added at 0.1, 0.2, 0.5, 1.0 and 2.0 molar ratio to rhSCF; 100 ng/ml P0 along with 23C8 was added at 0.1, 0.2, 0.5 and 2.0 molar ratio to P0. The mAb or the buffer was pre-incubated with rhSCF or P0 at 37°C for 0.5 h before they were added to the assay wells. All groups were cultured for 6 days in an incubator with humidified air containing 5% CO₂. Culture medium was replenished on the third day post planting. Total cell number was monitored using hemocytometer, whereas CD34⁺ cell number was calculated based on the total cell number and the proportion of CD34⁺ cells determined via flow cytometry (BD, USA) on day 6 of culture, using the anti-human CD34 monoclonal antibody conjugated with PE fluorescein (Miltenyi Biotec, Germany).

Shen B., Jiang W., Fan J., Dai W., Ding X, & Jiang Y. (2015). Residues 39-56 of Stem Cell Factor Protein Sequence Are Capable of Stimulating the Expansion of Cord Blood CD34+ Cells. PLoS ONE, 10(10), e0141485.

+ Open protocol

+ Expand

Culturing Human Cell Lines and CD34+ Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

TF1 and HEK293 cells were purchased from the American Type Culture Collection. MDSL was provided by Dr. Kaoru Tohyama (Kawasaki Medical School, Okayama, Japan). TF1 and MDSL cells were cultured in RPMI 1640 medium plus 10% FBS and 10ng/mL human recombinant interleukin 3 (rhIL-3, 02603, StemCell Technologies). HEK293 cells were maintained in DMEM media with 10% FBS. Human CD34⁺ cord blood cells were prestimulated in StemSpan SFEM supplemented with recombinant human stem cell factor (rhSCF; 02830 Stemcell Technologies), recombinant human Flt3 ligand (rhFL; 02840, Stemcell Technologies), recombinant human thrombopoietin (rhTPO; 02522, PeproTech) at 100ng/mL for 48 hours before transduction, and then maintained in rhSCF, rhFL, rhTPO, rhIL-3, and recombinant human IL-6 (rh IL-6; 02606 Stemcell Technologies) at 10ng/mL.

Fang J., Bolanos L., Choi K., Liu X., Christie S., Akunuru S., Kumar R., Wang D., Chen X., Greis K.D., Stoilov P., Filippi M.D., Maciejewski J.P., Garcia-Manero G., Weirauch M.T., Salamonis N., Geiger H., Zheng Y, & Starczynowski D.T. (2016). Ubiquitination of the spliceosome auxiliary factor hnRNPA1 by TRAF6 links chronic innate immune signaling with hematopoietic defects and myelodysplasia. Nature immunology, 18(2), 236-245.

+ Open protocol

+ Expand

Recombinant SCF Expression in E. coli

Check if the same lab product or an alternative is used in the 5 most similar protocols

The PQE60 plasmid and E.Coli BL 21 were obtained from QIAGEN (Valencia, CA, USA). Isopropyl-1-thio-ß- D-galactopyranoside (IPTG) was from Bio-Basic Inc (Amherst, NY, USA) to induce recombinant SCF expression in bacteria. Guanidine Hydrochloride was from Amresco Inc (Solon, OH, USA). Urea was from Shanghai Experimental Reagent Inc (Shanghai, China). RPMI 1640 medium and STEM PRO®-34 SFM medium were from Gibco (Grand Island, NY, USA). Fetal bovine serum was from Hyclone (Logan, UT, USA). Goat-anti-mouse immunoglobulin G (IgG) conjugated with alkaline phosphatase was from Biolegend (Canada). Prestained protein molecular weight marker was from Bio-Rad (USA). Biotin conjugated goat anti-mouse-IgG was from Biolegend (San Diego, CA, USA). Mouse monoclonal antibody isotyping reagent kit and streptavidin-peroxidase was from Sigma-Aldrich (St. Louis, MO, USA). MACS immunomagnetic absorption column separation device and CD34 MicroBead Kit, was from Miltenyi Biotec (Germany). rhTPO and rhFLT-3 were from Pepro Tech (USA). Anti-human CD34 mAb conjugated with phycoerythrin was from Immunotec (Canada). Peptides were synthesized by Nanjing Genscript Inc. (Nanjing, China).

+ Open protocol

+ Expand

Cell Line and Primary Cell Cultivation

Check if the same lab product or an alternative is used in the 5 most similar protocols

Nalm6, K562, Namalwa cell lines used in this study were purchased from American Type Culture Collection (ATCC). CD19 knockout Nalm6 cell line (Nalm6^CD19KO), luciferase transfected Nalm6 cell line (Nalm6^luciferase) and CD19 overexpression K562 (K562^CD19) cell line were constructed previously and preserved in our lab. All the tumor cell lines were grown in RPMI-1640 with 10% fetal bovine serum (FBS) at 37 °C with 5% CO₂.
Blood samples of B-ALL patients admitted to Institute of Hematology & Blood Diseases Hospital, Chinese Academy of Medical Sciences & Peking Union Medical College (CAMS & PUMC), were collected and cultured in IMDM supplemented with 15% FBS, 100 ng/ml rhFLT3-L, 100 ng/ml rhSCF and 50 ng/ml rhTPO (PeproTech, USA).
Human T cells from healthy donors were isolated using Human T Cells Enrichment Cocktail (STEMCELL, USA) according to the manufacturer’s protocol. Patient derived T cells were isolated from B-ALL patients and cultured in lymphocyte medium KBM581 (Corning, USA) supplemented with 10% FBS and 50 IU/mL human interleukin-2 (IL-2) (R&D systems, USA).

Chen M., Liu X., Peng N., Zhang T., Mou J., He H., Wang Y., Xu Y., Xing H., Tang K., Tian Z., Rao Q., Gu R., Qiu S., Wang M, & Wang J. (2023). Construction of CD19 targeted dual- and enhanced dual-antibodies and their efficiency in the treatment of B cell malignancy. Experimental Hematology & Oncology, 12, 64.

+ Open protocol

+ Expand

Murine Megakaryocyte Generation and Ploidy

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Murine bone-marrow (BM)-derived progenitor cells [13 (link)] were cultured as described [10 (link)] using 100 ng/mL recombinant human thrombopoietin (rhTPO;Peprotech, Rocky Hill, NJ). Flow cytometry data was acquired using a FACSAria flow cytometer (BD Biosciences). Ploidy assays used previously published methods [14 (link)]. Polyploid murine Mks were defined as cells with high forward scatter, CD41 expression, and ≥8n DNA content.

Lindsey S., Jiang J., Woulfe D, & Papoutsakis E. (2014). Platelets from mice lacking the aryl hydrocarbon receptor (AHR) exhibit defective collagen-dependent signaling. Journal of thrombosis and haemostasis : JTH, 12(3), 383-394.

+ Open protocol

+ Expand

CRISPR/Cas9-Mediated DNMT3A Deletion in Human CD34+ Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

DNMT3A deletion was conducted on human CD34+ cells according to the method of Gundry et al (Gundry et al., 2017) by using two separate single guide RNAs (sgRNAs) targeted to exon thirteen of human DNMT3A. Guide sequences were: AGGUGGCCAGCAGCCGCGCG - modified and UGACACUGCCAAGGCCGUGG - modified. Mixed guide RNAs were used at 0.5 ug/ul final concentration for each guide, mixed with 1 ug Cas9 protein (PNA Bio) and transduced into CD34+ cells by electroporation. Gene deletion was confirmed by PCR and realtime using the following primers; forward, GATGGAATCGCTACAGGGCT and reverse: CCCCCAATCACCAGATCGAAT.
Human CD34+ cells were isolated from buffy coat samples by enrichment using anti-CD34 magnetic microbeads (Macs, Miltenyi). CD34+ blood cells were expanded in StemSpan SFEM (Stem Cell Technologies) supplemented with 100ng/ml rhFLT-3L, 100ng/ml rhSCF, 100ng/ml rhTPO and 20ng/ml IL-3 (Preprotech). Differentiation of human cells was measured by incubation of CD34+ cells in the above media with IFNy (1000 U/mL) for 3 days. Cells were characterized by flow cytometry using anti CD45, CD34, CD38 and CD66b antibodies (eBioscience, Biolegend, and BD Pharmingen) (Yang et al., 2005). Each experimental replicate was conducted with cells from a different biological sample, representing a different individual.

Hormaechea-Agulla D., Matatall K.A., Le D.T., Kain B., Long X., Kus P., Jaksik R., Challen G.A., Kimmel M, & King K.Y. (2021). Chronic Infection drives Dnmt3a-Loss of function Clonal Hematopoiesis via IFNg signaling. Cell stem cell, 28(8), 1428-1442.e6.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!