Tris acetaterunning buffer

Manufactured by Thermo Fisher Scientific

Sourced in Canada, United States

Tris-acetate running buffer is a solution used in electrophoresis procedures, specifically for the separation and analysis of biomolecules such as nucleic acids and proteins. The buffer assists in maintaining the appropriate pH and ionic strength to facilitate the migration of these molecules through the gel matrix during the electrophoresis process.

Automatically generated - may contain errors

Lab products found in correlation

10 protocols using tris acetaterunning buffer

Protein Separation and Visualization

Check if the same lab product or an alternative is used in the 5 most similar protocols

Samples were centrifuged at 16,000g for 5 min to separate the soluble fraction (supernatant) from the insoluble fraction (pellet). Both fractions were dissolved in NuPAGE LDS sample buffer (Life Technologies, Carlsbad, CA) with and without 50 mM DTT (BioRad) and incubated at 80°C for 90 s. Approximately 10 μg of each sample was separated on a 3-8% Tris-Acetate gel using Tris-Acetate running buffer (Life Technologies) for 65 min at 150V. A Hi-Mark unstained molecular weight ladder was used as a reference (Life Technologies). The starting protein concentration for the supernatant of one sample (stir-D3) was low so a maximum of 20 μL was loaded. Protein bands were visualized by staining with Bio-Safe Coomassie blue (BioRad).

Telikepalli S.N., Kumru O.S., Kalonia C., Esfandiary R., Joshi S.B., Middaugh C.R, & Volkin D.B. (2014). Structural Characterization of IgG1 mAb Aggregates and Particles Generated under Various Stress Conditions. Journal of pharmaceutical sciences, 103(3), 796-809.

+ Open protocol

+ Expand

SDS-PAGE Protein Separation

Check if the same lab product or an alternative is used in the 5 most similar protocols

Each sample other than the FACS sorted samples was dissolved in NuPAGE LDS sample buffer (Life Technologies, Carlsbad, California) with and without 50 mM dithiothreitol (BioRad Laboratories, Hercules, CA) and incubated at 90°C for 5 min. Approximately 3 μg of each sample was separated on a 3–8% Tris-acetate gel using Tris-acetate running buffer (Life Technologies) for 65 min at 150V. A Hi-Mark unstained molecular weight ladder was used as a reference (Life Technologies). Protein bands were visualized by staining with Colloidal Coomassie (Invitrogen, Carlsbad, CA) according to the manufacturer’s instructions.

Telikepalli S., Shinogle H.E., Thapa P.S., Kim J.H., Deshpande M., Jawa V., Middaugh C.R., Narhi L.O., Joubert M.K, & Volkin D.B. (2015). Physical characterization and in vitro biological impact of highly aggregated antibodies separated into size-enriched populations by fluorescence-activated cell sorting. Journal of pharmaceutical sciences, 104(5), 1575-1591.

+ Open protocol

+ Expand

NF1 Knockdown and RAS-GTP Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Knock-down of NF1 was achieved by lentiviral transduction of BEAS-2B cells with MISSION shRNA (Sigma Aldrich) having the following sequence:

5’- CCGGCCATGTTGTAATGCTGCACTTCTCGAGAAGTGCAGCATTACAACATGGTTTTTG-3’

and being expressed from a pLKO.1-puro plasmid backbone. One day after lentiviral transduction, cells were selected via treatment with 1 μg/mL puromycin for 48 hours. For RAS-GTP analysis, cells were seeded at a density of 1×10⁶ cells per 10 cm dish. One day post seeding, cells were starved in serum-free media for 18 hours and treated with either vehicle (DMSO) or RMC-4550 (1 μM) for 1 hour. Cells were stimulated with 100 ng/mL hEGF (Sigma) for 5 minutes prior to harvest. Cell lysates were prepared and RAS-GTP levels were determined via RAF-RBD mediated pull-down using the RAS Pull-down Activation Assay Biochem Kit (Cytoskeleton, Inc.). Western blot analysis was performed for RAS, pERK, ERK, and HSP90 as outlined previously. For NF1 analysis, SDS-PAGE was performed using 3–8% Tris-Acetate gels and Tris-Acetate running buffer (Novex) prior to western blot analysis using an antibody against NF1 (Santa Cruz Biotechnology).

Nichols R.J., Haderk F., Stahlhut C., Schulze C.J., Hemmati G., Wildes D., Tzitzilonis C., Mordec K., Marquez A., Romero J., Hsieh T., Zaman A., Olivas V., McCoach C., Blakely C.M., Wang Z., Kiss G., Koltun E.S., Gill A.L., Singh M., Goldsmith M.A., Smith J.A, & Bivona T.G. (2018). RAS nucleotide cycling underlies the SHP2 phosphatase dependence of mutant BRAF-, NF1- and RAS-driven cancers. Nature cell biology, 20(9), 1064-1073.

+ Open protocol

+ Expand

Western Blot Protein Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cells were lysed using RIPA buffer consisting of 50 mM Tris-Cl (pH 8.0), 1% Triton X, 0.5% sodium deoxycholate, 0.1% SDS, and 150 mM NaCl for 15 min on ice and then centrifuged at 15,000× g for 10 min to remove debris. Protein concentration in the supernatants was quantified using the Bradford assay (Biorad, 5000006) with a spectrophotometer. Tris-acetate running buffer (Novex, Waltham, MA, USA, LA0041) and 3–8% tris-acetate NuPAGE gel (Invitrogen, Waltham, MA, USA, EA0375BOX) were used for electrophoresis, and proteins were transferred to PVDF membranes (Invitrogen, IB24002) with the iBlot 2 dry blotting system under 20 V for 10 min. The membranes were subsequently blocked with 5% milk and incubated with ANCO1 (Abcam, Cambridge, UK, ab50852, 1:50) or ACTIN (Millipore, Burlington, MA, USA, MAB1501, 1:15,000) antibodies overnight at 4 °C. Membranes were then washed and incubated with secondary antibody (GE Healthcare, Chicago, IL, USA, NA931V, 1:10,000) for 1 h at room temperature. The Immobilon Western Chemiluminescent HRP Substrate (Millipore, WBKLS0500) was used for signal development. Quantification was performed with ImageJ.

Yuan M., Barefoot M.E., Peterson K., Campbell M.J., Blancato J.K., Chen M., Schmidt M.O., Kiliti A.J., Fang H.B., Wellstein A., Riegel A.T, & Sharif G.M. (2023). Loss of ANCO1 Expression Regulates Chromatin Accessibility and Drives Progression of Early-Stage Triple-Negative Breast Cancer. International Journal of Molecular Sciences, 24(14), 11505.

+ Open protocol

+ Expand

NF1 Knockdown and RAS-GTP Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Knock-down of NF1 was achieved by lentiviral transduction of BEAS-2B cells with MISSION shRNA (Sigma Aldrich) having the following sequence:

5’- CCGGCCATGTTGTAATGCTGCACTTCTCGAGAAGTGCAGCATTACAACATGGTTTTTG-3’

+ Open protocol

+ Expand

Western Blot Protein Analysis Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

The experiment reported in Fig. 4c used a
4–12% NuPAGE Bis-Tris 1.5-mm gel in Mops buffer (Invitrogen); all other
experiments used 3–8% NuPAGE Tris-acetate 1.5-mm gels in Tris-acetate
running buffer (Invitrogen). Gels were typically run until tracking dye exited the gels,
except for those used for comigration or crosslinking experiments, which were typically
run about twice as long.
Following separation on SDS polyacrylamide gels, we transferred proteins to PVDF
membranes (Millipore Immobilon-FL) and detected them by Western blotting, using
appropriate antibodies. Membranes were blocked with Li-Cor Odyssey blocking buffer, and
washes were carried out in PBS (phosphate-buffered saline) buffer with 0.1% (v/v)
Tween-20. Primary and secondary incubations were in PBS-Tween with 10% (v/v)
Odyssey blocking buffer, the latter also containing 0.01% SDS. Following a final
wash in PBS, we scanned dried membranes on a Li-Cor Odyssey IR imager, and the images were
analyzed using GE ImageQuant TL software. Antibodies were titrated and exposures set to
ensure that all bands were in a linear response range. For amino acid sequence
determination, proteolytic fragments were transferred to a PVDF membrane, excised and
subjected to automated N-terminal protein sequencing at the Tufts University Core
Facility.

Taylor A.F., Amundsen S.K., Guttman M., Lee K.K., Luo J., Ranish J, & Smith G.R. (2014). Control of RecBCD Enzyme Activity by DNA Binding- and Chi Hotspot-Dependent Conformational Changes. Journal of molecular biology, 426(21), 3479-3499.

+ Open protocol

+ Expand

Western Blot Analysis of Limb Bud Proteins

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cells and dissected limb buds were lysed in a 1%TX-100 lysis buffer and processed as described previously [32 (link)]. For the limb buds, cytoplasmic and nuclear fractions were separated using NE-PER® nuclear and cytoplasmic protein extraction kit (Thermo Scientific). Proteins (30μg) were resolved by SDS-PAGE using 3–8% Tris-acetate gradient gels with Tris-acetate Running Buffer (Invitrogen) and wet-blotted onto PVDF membrane (Millipore) overnight at 4°C using Towbin buffer. Membranes were blocked in 5% milk/PBS at room temperature (RT) for one hour and incubated with primary antibodies against: UBR5 (Santa Cruz goat EDD M-19 1:2500); β-tubulin (Sigma mouse 1:30,000) and HP-1 (Chemicon mouse 1:10,000) for one hour at RT in 0.1% Tween PBS (PBST). Membranes were then washed three times in PBST at RT, incubated with appropriate secondary antibodies: donkey αgoat-HRP and horse αmouse-HRP, both (Jackson Labs 1:10,000) and washed three times in PBST at RT. Membranes were then incubated in ECL solution and imaged using the digital ChemiDoc imaging system (Promega).

Kinsella E., Dora N., Mellis D., Lettice L., Deveney P., Hill R, & Ditzel M. (2016). Use of a Conditional Ubr5 Mutant Allele to Investigate the Role of an N-End Rule Ubiquitin-Protein Ligase in Hedgehog Signalling and Embryonic Limb Development. PLoS ONE, 11(6), e0157079.

+ Open protocol

+ Expand

SDS-PAGE and Western Blot Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Samples were prepared in 6× Laemmli sample buffer heated at 99°C for 4 min and separated on 4–12% Bis–Tris NuPage gels (Invitrogen) in 1× MOPS running buffer (Invitrogen) or 3–8% Tris–Acetate gels (Invitrogen) in Tris–Acetate running buffer (Invitrogen). Proteins were transferred onto nitrocellulose membrane (Cytiva LifeSciences) and images captured using an Odyssey SLX LiCor Scanner (Licor Bioscience) when using fluorescently labelled secondary antibodies or transferred onto PVDF (Cytiva LifeSciences) when detected using enhanced chemiluminescence detection (Pierce SuperSignal West Pico Chemiluminescent Substrate 34087; ThermoFisher Scientific) and images captured using an ImageQuant LAS4000 (Cytiva LifeSciences) CCD. Quantification of MTBP was carried out using pre-diluted Bovine Gamma Globulin protein assay standards (Pierce 23213; ThermoFisher Scientific) and analysed using Image Studio Lite LICOR software.
For protein visualization, gels were stained with either SYPRO Ruby (ThermoFisher Scientific) and de-stained with 10% ethanol and 7% acetic acid in H₂O or with Coomassie R-250 and de-stained with 40% ethanol and 10% acetic acid in H₂O.

Volpi I., Gillespie P.J., Chadha G.S, & Blow J.J. (2021). The role of DDK and Treslin–MTBP in coordinating replication licensing and pre-initiation complex formation. Open Biology, 11(10), 210121.

+ Open protocol

+ Expand

Characterization of Coagulation Factor VIII

Check if the same lab product or an alternative is used in the 5 most similar protocols

Ten units of N8‐GP or N8 in Hepes buffer was incubated with half the volume of APTT‐SP or APTT‐SP diluted to various degrees with APTT‐SP supernatant. For this purpose, APTT‐SP supernatant was collected after spinning APTT‐SP for 10 minutes at 10 000 g. After 5 minutes of incubation at 37°C, the mixture was centrifuged for 10 minutes at 10 000 g. A sample of the supernatant (65 μL) was transferred to 35 μL reducing sample buffer, and 18 μL (~1.4 U of N8‐GP/N8) was eventually applied on a polyacrylamide gel. SDS‐PAGE was performed using a 7% NuPAGE Novex Tris‐acetate gel and Tris‐acetate running buffer (Invitrogen, Carlsbad, CA), and proteins were silver‐stained.

Persson E., Foscolo T, & Hansen M. (2018). Reagent‐specific underestimation of turoctocog alfa pegol (N8‐GP) clotting activity owing to decelerated activation by thrombin. Research and Practice in Thrombosis and Haemostasis, 3(1), 114-120.

+ Open protocol

+ Expand

Protein Separation and Visualization Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

Samples were prepared in 6x Laemmli sample buffer heated at 99°C for 4 minutes, and separated on a 4-12% BisTris NuPage gels (Invitrogen) in 1x MOPS running buffer (Invitrogen)
or 3-8% Tris-Acetate gels (Invitrogen) in Tris-Acetate running buffer (Invitrogen). Proteins were transferred onto nitrocellulose membrane (GE Healthcare) and images captured using an Odyssey SLX LiCor Scanner (Licor Bioscience) when using fluorescently labelled secondary antibodies or transferred onto PVDF (GE Healthcare) and detected using enhanced chemiluminescence detection (SuperSignal West Pico Chemiluminescent, Thermo Scientific 34087). Images were captured using either an ImageQuant LAS4000 (GEHC) CCD.
For protein visualisation gels were stained with either Sypro Ruby and de-stained with 10% ethanol, 7% acetic acid, in H 2 O or with Coomassie R-250 and de-stained with 40% ethanol, 10% acetic acid in H 2 O. Quantification of the immunoblots were carried out using pre-diluted protein assay standards (Thermo Scientific 23213), and analysed using Image Studio Lite LICOR software.

Volpi I., Gillespie P.J., Singh G., & Blow J.J. (2021). The role of DDK and Treslin-MTBP in coordinating replication licensing and pre-Initiation Complex formation.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!