The largest database of trusted experimental protocols

38 protocols using pei transfection reagent

1

Poly I:C Transfection and Zika Virus Infection

Check if the same lab product or an alternative is used in the 5 most similar protocols
The dsRNA viral mimic, poly I:C (Invivogen, San Diego, CA, USA), was transfected into cells using PEI transfection reagent (Sigma-Aldrich, St. Louis, MO, United States) as per manufacturer’s instructions at a concentration of 1 µg/mL. Control stimulated cells received PEI transfection reagent only. poly I:C tagged with Rhodamine was used at 1 µg/mL to quantify the percentage of cells stimulated by poly I:C in our experiments. Zika virus (ZIKV MR777 strain) was used to infect primary immortalised astrocyte cells. Cells were washed with phosphate-buffered saline (PBS) at the indicated multiplicity of infection (MOI) in DMEM without FCS. After 2 h of incubation, the infection medium was removed and replaced with DMEM containing 10% (v/v) FCS.
+ Open protocol
+ Expand
2

Lentiviral Expression of IRGM1 and CUL4B

Check if the same lab product or an alternative is used in the 5 most similar protocols
The ORF of mouse Irgm1 (Myc-DDK-tagged) and Cul4b (Myc-DDK-tagged) were purchased from Origene and cloned into the lentiviral expression vector (pCDH-CMV-MCS-EF1-Puro, one kind gift of Dr. Jupeng Yuan, Shandong Cancer Hospital and Institute, China) or the His-Tag lentiviral expression vector (pLent-EF1a-FH-CMV-GFP-P2A-puro purchased from vigene).
For transfection, HEK293T cells were cultured to the concentration of 30%. Transfection was performed in 500 μl opti-DMEM with 20 μl siRNA or control with addition of 30 μl X-tremeGene (Roche, Mannheim, Germany) according to the manufacturer’s instruction. 2 μg constructions for ectopic expression of CUL4B, IRGM1 and HA-Ubiquitin were transfected by PEI transfection reagent (Merck) as indicated respectively. After 48 h incubation, MG132 was added at a final concentration of 10 μM. The cells were then harvested after 3 h incubation.
+ Open protocol
+ Expand
3

Knockdown of AC087388.1 using shRNA

Check if the same lab product or an alternative is used in the 5 most similar protocols
AC087388.1 small hairpin RNA (shRNA) was synthesized by Metabion (Munich, Germany). The sequence was 5′-GCAAGAATGAGTATATCTATACCTGACCCATATAGATATACTCATTCTTGCTTTTT -3′. A scrambled negative control shRNA was also ordered from Metabion (Munich, Germany). The sequence was 5′- CCGGTACCTCACGTCAGTGGTGATATAGATCAAGAGTCTATATCACCACTGACGTTTTG -3′. The cells lines were incubated with either AC087388.1 shRNA (shRNA) or negative control shRNA (as control) using polyethylenimine (PEI) transfection reagent (Merck KGaA, Darmstadt, Germany) according to the manufacturer protocol.
+ Open protocol
+ Expand
4

Knockdown of Key Transcription Factors

Check if the same lab product or an alternative is used in the 5 most similar protocols
We used short hairpin RNAs (shRNAs) to knock down the TFs and knockdown efficiency was assessed with real-time quantitative PCR (RT-qPCR). The following TFs were knocked down with shRNAs, including SIN3A, SMC3, CTCF, RAD21, and REST. The annealed shRNAs were ligated into the pLKO.1 vector, and the constructed vectors were used to transform Stbl3 competent cells (Beyotime, Cat.No: D0378) (produced using the Supercompetent Cell Preparation Kit (Beyotime, Cat.No: D0302)). DNA sequencing was used to verify the sequences of the inserted shRNAs. Lentiviral packaging vectors pMD2.G (Addgene, Cat. No: 12259) and psPAX2 (Addgene, Cat. No: 12260) and shRNA-expressing vector were cotransfected into HEK293T cells using the PEI transfection reagent (Sigma, Cat. No: 408727). Forty-eight hours posttransfection, the viral supernatants were harvested, filtered, and directly added into the culture medium of SH-SY5Y cells. The cells were selected with puromycin (2μg/mL) (Sigma, Cat. No: 540222) for 1 week. The shRNA sequences are provided in Additional file 1, Table S3.
+ Open protocol
+ Expand
5

Lentiviral and Retroviral Particle Production

Check if the same lab product or an alternative is used in the 5 most similar protocols
Replication defective lentiviral infectious particles were packaged using HEK293 T cells. Cells were seeded (2 million) in a 10 cm culture plate and grown overnight to obtain a confluent of 70–80% cells in the culture plate. Subsequently, the cells were transfected with three different plasmids containing the main components of the lentiviral particles: the plasmid containing the target shRNA sequence, an envelope-coding plasmid (pMD.G), and a plasmid coding a gag-pol sequence (psPAX2) (or for retroviral particles: the plasmid containing the target sequence (PBSpro/PBSgln GFP), a VSV-G envelope coding plasmid (pMD.G) and a plasmid coding a gag-pol sequence (pCL-ECO)) in ratio of 30:3:27 (in μg), respectively. The transfection process was facilitated using a polyethylenimine (PEI) transfection reagent (Sigma) in a DNA/PEI ratio of 1:2. Finally, the supernatant containing the lentiviral particles was harvested 48 and 72 h after transfection, filtrated through a 45 nm filter, followed by the addition of polybrene (Merck) at a concentration of 10 μg/mL to improve the infection rate.
+ Open protocol
+ Expand
6

Efficient Transfection of HEK293 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
HEK293 and HEK293T cells were cultured in DMEM containing 10% FBS, 100 units/ml penicillin, and 100 μg/ml streptomycin. Transfection was performed with METAFECTENE PRO (Biontex) or PEI transfection reagent (Sigma-Aldrich) according to the manufacturer’s protocol. The siRNAs used in HEK293T are listed in Supplementary Table 2. The siRNA sequences targeting TNKS or TNKS2 were described previously27 (link).
+ Open protocol
+ Expand
7

HEK293T Cell Transfection and GST-Pulldown

Check if the same lab product or an alternative is used in the 5 most similar protocols
HEK293T cells were transfected with the indicated expression vectors using PEI transfection reagent (Sigma-Aldrich) and then subjected to GST-pull down assays or co-IP.
+ Open protocol
+ Expand
8

Isolation and Transfection of Mouse Dermal Fibroblasts

Check if the same lab product or an alternative is used in the 5 most similar protocols
Adherent mammalian cells were cultured in DMEM (PAN Biotech) supplemented with 10% fetal calf serum and antibiotics.
Neonatal animals were used in our studies; age and sex-matched littermates were used as controls. New born mice (day 1 old) were decapitated and the whole skin of the torso was isolated. Dispase II (5 mg/ml) incubation of the skin overnight at 4 °C separated the dermis from epidermis. The isolated dermis was digested with Collagenase I (400 U/ml) for 1 h at 37 °C. The cells obtained were used between passages 2–8 for our experiments.
Mouse primary dermal fibroblasts were transfected as per the protocol of Amaxa Nucleofection kit (Lonza). For HEK293T cells, PEI transfection reagent (Sigma) (1 μg/μl) was used with DNA in a 3:1 ratio of PEI to DNA. Transfected cells were harvested after 24–48 h.
+ Open protocol
+ Expand
9

Protein Coexpression Analysis via Transfection

Check if the same lab product or an alternative is used in the 5 most similar protocols
Cells were transfected with expression vectors using PEI transfection reagent (Sigma-Aldrich). For the coexpression assays, 293T cells were transfected with the indicated expression vectors. The transfected cells were analyzed using western blotting. The cell lysates were immunoprecipitated with the indicated antibodies and subsequently analyzed using western blotting.
+ Open protocol
+ Expand
10

Lentiviral Knockdown of KDM6B

Check if the same lab product or an alternative is used in the 5 most similar protocols
Gene-specific shRNA sequences were obtained from the Sigma website (http://www.sigmaaldrich.com/), and the hairpin sequences were cloned into the lentiviral vector pLKO-Tet-On with puromycinas as a selection marker, shRNAs targeting KDM6B were screened.
Lentiviral particles were packaged in HEK 293 T cells by transient transfection. Briefly, 10 μg of shRNA encoding lentiviral plasmid, 5 μg of helper pMD2.G plasmid and 10 μg of helper psPAX2 plasmid were mixed with 30 μl PEI transfection reagent (Sigma-Aldrich). And co-transfected into HEK 293 T cells at 70–80% confluency in a 10 cm Petri dish according to the manufacturer’s protocol. At 72 h post-transfection, the supernatant containing virus particles was collected and filtered through a 0.45 μm PVDF Millex syringe filter.
Each cell line was subjected to a puromycin tolerance test to determine the optimal concentration for establishing stable cell lines. To generate an shRNA-expressing stable cell line, cells were infected with lentiviral particles with 4 μg/ml polybrene. After 48 h, the cells were selected by 1 μg/ml puromycin (GIBCO) for 5 days. And the knockdown efficiency was tested by WB assay and RT-qPCR.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!