RNA was isolated from primary CD4+ T cells or Jurkats using RNABee or RNAStat (Tel-Test, Inc) according to the manufacturer’s protocol. Low-cycle radioactive RT-PCR was performed and analyzed as previously described in detail (Ip et al., 2007 (link); Lynch and Weiss, 2000 (link); Rothrock et al., 2003 (link)). Primer sequences used for splicing analysis include: caspase-9 (F: GGCCAGGCAGCTGATCATAGATCTG R: GGAGGCCACCTCAAACCCATGGTC ), Bim (F: CCTTCTGATGTAAGTTCTGAGTGTGAC R: CCATATCTCTGGGCGCATATCTGC ), Bax (F: CTCTGAGCAGATCATGAAGACAGG R: GAAAACATGTCAGCTGCCACTCG ), and Caspase-1 (F: GAGCAGCCAGATGGTAGAGCGCAG R: CCTTTACAGAAGGATCTCTTCACTTC ).
Rna stat
Manufactured by Tel-Test
RNA-STAT is a laboratory instrument designed for the extraction and purification of RNA from a variety of sample types. It utilizes a specialized buffer system and centrifugation to isolate high-quality RNA for downstream applications such as reverse transcription and gene expression analysis.
Automatically generated - may contain errors
Lab products found in correlation
Agilent 2100 bioanalyzer, by Agilent Technologies (2 mentions)
Typhoon phosphorimager, by Cytiva (2 mentions)
M mlv rt, by Thermo Fisher Scientific (2 mentions)
Sybr green maxima mix, by Bio-Rad (2 mentions)
Dnase, by Thermo Fisher Scientific (2 mentions)
Myiq2 two color real time pcr detection system, by Bio-Rad (2 mentions)
Dna free kit, by Thermo Fisher Scientific (2 mentions)
Iscript cdna synthesis kit, by Bio-Rad (2 mentions)
Qscript cdna supermix, by Quantabio (2 mentions)
Iq sybr green supermix, by Bio-Rad (2 mentions)
Nanodrop 2000, by Thermo Fisher Scientific (2 mentions)
Revertaid first strand cdna synthesis kit, by Thermo Fisher Scientific (2 mentions)
Rna bee, by Tel-Test (1 mentions)
Real time pcr instrument, by Thermo Fisher Scientific (1 mentions)
Quantstudio design and analysis software v1, by Thermo Fisher Scientific (1 mentions)
Faststart universal sybr green master rox, by Roche (1 mentions)
11 protocols using rna stat
1
RNA Isolation and Splicing Analysis
2
RNA Isolation and Quantitative PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA Stat (Tel Test, Friendswood, TX) was used to isolate total RNA from the LC. The RNA concentration was determined using NanoDrop 2000 (Thermo Fisher Scientific, Pittsburgh, PA) and 600 ng subjected to reverse transcription with the RevertAid First Strand cDNA Synthesis Kit (Thermo Fisher Scientific) using an oligo dT primer. The cDNA (2 μl) was mixed with 12.5 μl of FastStart Universal SYBR Green Master Rox (Roche Diagnostics, Indianapolis, IN) and 1 μl of one of the following primer sets: NET, (PPRO6785A-200, Qiagen) and GAPDH, (forward 5′-TGGACCACCCAGCCCAGCAAG-3′, reverse 5′-GGCCCCTCCTGTTGTTATGGGGT-3′), to a final volume 25 μl. Reactions were run on a real-time PCR instrument (Applied Biosystems, Carlsbad, CA) and data were analyzed using QuantStudio™ Design and Analysis Software v. 1.4.1. Data normalizing to GAPDH for the same sample, were calculated using the ΔΔCt method (Livak and Schmittgen, 2001 (link)) and are presented as a ratio change relative to the mean of the unstressed controls taken as 1.0.
3
Transcriptomic Analysis of HDAC7 Mutant Cell Lines
4
Quantitative Analysis of Alternative Splicing
5
Quantifying Mitochondrial Gene Expression
6
RNA Isolation and qRT-PCR Analysis in C. elegans
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA isolation and quantitative reverse-transcriptase PCR (qRT-PCR) analysis were previously described11 (link). Worms were synchronized by bleaching, raised on HT115 E. coli and harvested at the L4 stage. Total RNA was extracted from frozen worm pellets using RNA STAT (Tel-Test) and 500 ng RNA was used for cDNA synthesis with qScript™ cDNA SuperMix (QuantaBio). qPCR was performed using iQ™ SYBR® Green Supermix (Bio-Rad Laboratories). qPCR primers are listed in Supplementary Data file 6 . All qPCR results were repeated at least 3 times and performed in triplicates. A two-tailed Student’s t-test was employed to determine the level of statistical significance.
7
Transcriptomic Analysis of HDAC7 Mutant Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Wild-type JSL1 (one clone) and CRISPR cells (HDAC7-iE9, one clone; HDAC7-ΔE9, three clones) were incubated for 48 h −/+ PMA (see above). Total RNA was extracted using RNA-STAT (Tel-Test, Inc.). RNA quality was assessed using a Nanodrop and Agilent 2100 Bioanalyzer. Samples were required to have a 260/280 ratio of >1.8 as well as a RIN value of >6 to be used for library preparation. Poly(A) selected cDNA libraries were generated on site at Genewiz (now Azenta Life Sciences, NJ, USA) using standard methods. cDNA libraries were then sequenced for paired-end, 150-nt, reads on an Illumina HiSeq (16 samples total, ~350 million raw paired-end reads, ~25 million reads per sample). Data is publicly available at GEO: GSE213373. Raw reads were aligned to the human genome (hg38) using STAR.69 (link)
8
Quantitative Analysis of Alternative Splicing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Low-cycle reverse transcription (RT)-PCR analysis of alternative splicing events were performed according to standard methods.52 (link),74 (link) Primer sequences and RT-PCR conditions are provided in Table S1 . In brief, we isolated RNA form unstimulated or stimulated cells using RNA-STAT (Tel-Test, Inc.) and reverse transcribed (RT) the RNA using MMLV RT (28025013; Thermo) and sequence-specific primers. We set-up three independent RT-PCR reactions with 0.5 μg of RNA and used formamide buffer to run samples on 5% denaturing polyacrylamide gels (PAGE). Lastly, we detected the 32P labeled cDNA products by densitometry using a Typhoon PhosphorImager (Amersham Biosciences) and quantified product bands with ImageQuant software.
9
Quantifying Mitochondrial Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Worms were synchronized and raised in liquid culture until the L4 stage when they were harvested and compacted into pellets on ice. Total RNA was extracted from a 30–50 µl worm pellet using RNA STAT (Tel-Test). For the analysis of mtDNA-encoded mRNAs, the RNA extracts were then treated with DNAse using the DNA-free kit (Ambion) to reduce mtDNA contamination. 1 µg of RNA was used for synthesizing cDNA with the iScript cDNA Synthesis Kit (Bio-Rad Laboratories). qPCR was performed using the Thermo-Scientific SyBr Green Maxima Mix and the MyiQ2 Two-Color Real-Time PCR Detection System (Bio-Rad Laboratories). Primer sequences are listed in Supplementary Table 2 . All qPCR results are presented as technical replicates, but each experiment has been repeated 3 or more times. A Student’s t-test was employed to determine the level of statistical significance.
10
RNA Extraction and qRT-PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from ~5 mg frozen liver tissue by homogenization in 1 mL RNA-STAT (TelTest, Friendswood, TX) with isopropanol and ethanol precipitation and analyzed as performed previously.42 (link) Target gene cycle threshold (Ct) values were normalized to reference gene (Rplp0) Ct values by the 2 −ΔΔCt method. Oligonucleotide primer sequences are listed in Table A1 .
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!