Tprofessional standard gradient thermocycler

Manufactured by Analytik Jena

The TProfessional Standard Gradient thermocycler is a laboratory instrument designed for polymerase chain reaction (PCR) amplification of DNA samples. It features a gradient function that allows for the simultaneous optimization of annealing temperatures across multiple samples.

Automatically generated - may contain errors

Lab products found in correlation

Platinum pcr supermix high fidelity kit, by Thermo Fisher Scientific (2 mentions) Amicon ultra 0.5 ml kit, by Merck Group (2 mentions) Dpni, by New England Biolabs (1 mentions) Rnaiso reagent, by Takara Bio (1 mentions) Primescript rt master mix, by Takara Bio (1 mentions) Sybr green master mix, by Vazyme (1 mentions)

Spelling variants of this product

Thermocycler (94 citations) TProfessional Thermocycler (39 citations) Tprofessional Standard Thermocycler (6 citations) TProfessional (6 citations) Gradient Thermocycler (3 citations) TProfessional Gradient (2 citations)

4 protocols using tprofessional standard gradient thermocycler

Amplification of Viral Nucleic Acids

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

When a DNA template was used (de novo synthesized DNA or infectious clone), amplicons were generated by PCR using the Platinum PCR SuperMix High Fidelity kit (Life Technologies) and a Biometra TProfessional Standard Gradient thermocycler as previously described [8 (link)]. When a RNA template was used (nucleic acid extract from cell supernatant medium or mice brain suspension filtrate), amplicons were generated by RT-PCR using the Superscript III One-Step RT-PCR Platinum Taq High Fidelity kit (Life Technologies) and a Biometra TProfessional Standard Gradient thermocycler as previously described [8 (link)]. Primer sequences are detailed in Table B in S1 Text.
Size of the PCR products was verified by gel electrophoresis and purifications performed using the Amicon Ultra 0.5 ml kit (Millipore). When infectious clones were used as template, a digestion step with the restriction enzyme DpnI (New England Biolabs) was performed to remove the template. To control the efficiency of this additional step we transfected as a negative control an incomplete equimolar mix of the DNA fragments (without fragment II, 3μg final). This control did not produce any infectious virus as previously described [8 (link)].

Atieh T., El Ayoubi M.D., Aubry F., Priet S., de Lamballerie X, & Nougairède A. (2018). Haiku: New paradigm for the reverse genetics of emerging RNA viruses. PLoS ONE, 13(2), e0193069.

+ Open protocol

+ Expand

PCR Amplification of Arboviral Genomes

Check if the same lab product or an alternative is used in the 5 most similar protocols

Amplicons of JEV, CHIKV, YFV (ASIBI, 17D) and ZIKA (PF, DAK) viruses were produced using the Platinum PCR SuperMix High Fidelity kit (Life Technologies). The mixture (final volume, 50 µl) contained 45 µL of SuperMix, 2 µl of DNA template at 1 ng/µL (infectious clone or de novo synthesized DNA fragment) and 2 µL of each primer (10 µM working solution were used). Assays were performed on a Biometra TProfessional Standard Gradient thermocycler with the following conditions: 94 °C for 2 min followed by 40 cycles of 94 °C for 15 s, 60 °C for 30 s, 68 °C for 5 min and a final elongation step of 68 °C for 10 min. Size of the PCR products was verified by gel electrophoresis and purified using an Amicon Ultra 0.5 mL Kit (Millipore) according to the manufacturer’s instructions. Primers used are described in the Supplementary Table S2.

Atieh T., Nougairède A., Klitting R., Aubry F., Failloux A.B., de Lamballerie X, & Priet S. (2017). New reverse genetics and transfection methods to rescue arboviruses in mosquito cells. Scientific Reports, 7, 13983.

+ Open protocol

+ Expand

Quantitative Analysis of T-bet Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total cellular RNA was isolated by using RNAiso reagent (TaKaRa Bio, #9109) in accordance with the manufacturer’s instructions. In the Biometra TProfessional Standard Gradient Thermocycler (Biometra, #070-851), cDNA was synthesized with a PrimeScript^TM RT Master Mix (TaKaRa Bio, Inc., #RR036A) according to the manufacturer’s instructions. RT-qPCR was performed on a CFX96^TM real-time system (Bio-Rad, Model No.#CFX96^TM Optics Module) using SYBR Green Master Mix (Vazyme Biotech Co., Ltd., #Q121-02) per the manufacturer’s procedure. The specific primers used in this study were as follows: T-bet forward and reverse primers: 5′-GGTTGCGGAGACATGCTGA-3′ and 5′-GTAGGCGTAGGCTCCAAGG-3′, respectively; and human β-actin forward and reverse primers: 5′-CATGTACGTTGCTATCCAGGC-3′ and 5′-CTCCTTAATGTCACGCACGAT-3′, respectively. All gene expression was normalized to the level of human β-actin, which was used as an endogenous control.

Lu H., Shi T., Wang M., Li X., Gu Y., Zhang X., Zhang G, & Chen W. (2020). B7-H3 inhibits the IFN-γ-dependent cytotoxicity of Vγ9Vδ2 T cells against colon cancer cells. Oncoimmunology, 9(1), 1748991.

+ Open protocol

+ Expand

Mitochondrial DNA D-loop Sequencing Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

Genomic DNA was extracted from whole blood using commercial DNA‐Extran‐2 kits (CJSC Syntol), according to the manufacturer's instructions. The mtDNA D‐loop sequence, which was obtained from the NCBI database (GenBank accession number AF533441), was used as a reference to design primers (forward: 5′‐ CCCTAAGAGTCAAGGAAGAAGCC ‐3′ and reverse: 5′‐ GTGTGCTTGATACCTGCTCCTCT ‐3′) to amplify the 1437‐bp D‐loop region. Primers were synthesized by General Biology Co., Ltd. The PCR reaction volume was 50 μL, which included 1 μL of DNA template (75 ng/μL), 25 μL 2× Hieff PCR Master Mix, 2 μL of each primer (10 μmol/L), and 20 μL of ddH₂O. Amplification was performed using a TProfessional Standard Gradient Thermocycler (Biometra) under the following conditions: 94°C for 5 min; 22 cycles of 94°C for 30 s, 55°C for 30 s, and 72°C for 90 s; and a final extension at 72°C for 10 min. The quality of PCR products was evaluated using 1% agarose gel electrophoresis with ethidium bromide (0.5 μg/mL).
E‐Gel CloneWell II agarose gels (Thermo Fisher) were used to purify the PCR products. Purified PCR products were submitted to General Biology (Anhui) for Sanger sequencing from both ends.

Qin W., Chen D., Guo P., Hu L., Zheng X., Cheng J, & Chen H. (2023). Ecogroups and maternal haplogroups reveal the ancestral origin of native Chinese goat populations based on the variation of mtDNA D‐loop sequences. Ecology and Evolution, 13(8), e10382.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!