Neb luna universal probe one step rt qpcr kit

To extract RNA from lung tissue, 25 mg of lung tissue was first homogenized in a bead mill (Analytic Jena). RNA was isolated from oral swabs, oropharyngeal swabs, and the homogenized lung tissue using the innuPREP Virus DNA/RNA Kit (Analytik Jena, Jena, Germany). Total SARS-CoV-2 RNA was quantified by quantitative reverse transcription PCR (RT-qPCR), employing the forward primer E_Sarbeco_F1 (ACAGGTACGTTAATAGTTAATAGCGT), the reverse primer E_Sarbeco_R2 (ATATTGCAGCAGTACGCACACA), and the probe E_Sarbeco_P1 (FAM-ACACTAGCCATCCTTACTGCGCTTCG/ZEN/-IBFQ), which targeted the E gene region of SARS-CoV-2⁴⁵ . Subgenomic SARS-CoV-2 RNA transcripts were quantified using the same assay, except that the forward primer was substituted with the primer sgLeadSARSCoV2 (CGATCTCTTGTAGATCTGTTCTC), which targeted the leader sequence of the SARS-CoV-2^{16 (link)}. The assay was performed on a qTower G3 cycler (Analytik Jena) using the NEB Luna Universal Probe One-Step RT-qPCR Kit (New England Biolabs) and the following cycling conditions: 10 min at 55 °C for reverse transcription, 3 min at 94 °C for activation of the polymerase and 40 cycles of 15 s at 94 °C and 30 s at 58 °C.

The cell lines used were MCF7 (Sigma, 86012803) and MDA-MB-231 (ATCC, HTB-26). Compounds were individually ordered (Selleck, Tocris and Sigma). CellsDirect Resuspension and Lysis Buffers (ThermoFisher, 11739010). CCK-8 cell counting kit (Sigma, 96992). NEB Luna Universal Probe One-Step RT-qPCR Kit (NEB, E3006 L). Thermo Fisher single-tube Taqman gene expression assays: AKT1, Hs00178289_m1; ATF4, Hs00909569_g1; BIRC5, Hs00977611_g1; BRCA1, Hs01556193_m1; BRCA2, Hs00609073_m1; CASP3, Hs00234387_m1; CCND1, Hs00765553_m1; CTNNB1, Hs00355049_m1; EGFR, Hs01076092_m1; ERBB2, Hs01001580_m1; ERBB3, Hs00176538_m1; ERBB3, Hs00951444_m1; ERBB3, Hs00951455_m1; ESR1, Hs01046812_m1; ESR1, Hs01046816_m1; HDAC1, Hs00606262_g1; HIF1A, Hs00153153_m1; HSP90, Hs00743767_sH; IL-8, Hs00174103_m1; MAPT, Hs00902194_m1; MELK, Hs01106440_m1; MMP-2, Hs01548727_m1; MMP-9, Hs00234579_m1; MTOR, Hs00234508_m1; NF-KB1, Hs00765730_m1; p21, Hs00355782_m1; p27, Hs01597588_m1; p300, Hs00914223_m1; p53, Hs01034249_m1; PDK1, Hs01561850_m1; PGR, Hs00172183_m1; PTEN, Hs02621230_s1; RASSF1, Hs00176538_m1; STAT3, Hs00374280_m1; STK11, Hs00975988_m1; TNF, Hs01113624_g1; TXNIP, Hs00197750_m1; uPA, Hs01547054_m1; VEGFA, Hs00900055_m1. All code used is available on request.

RNA was extracted from TRIzol treated apical wash samples using a QIAGEN RNeasy Mini kit (Qiagen, 74106) or in a 96-well plate format using the KingFisher Flex purification system (Thermo Scientific, 5400610) and RNAdvance kit (Beckman Coulter, A35604) following manufacturer’s protocols. SARS-CoV-2 RNA was quantified using a NEB Luna Universal Probe One-Step RT-qPCR Kit (New England Biolabs, E3006) and 2019-nCoV CDC N1 primers and probes (IDT, 10006713) or against the Orf1a open reading frame (Thermofisher, 4448508. Forward 5′- GACATAGAAGTTACTGGCGATAG-3′. Probe: VIC- ACCCCGTGACCTTGGTGCTTGT-MGB/NFQ. Reverse: 5′- TTAATATGACGCGCACTACAG-3′). Genome copy numbers were quantified using a standard curve generated from serial dilutions of an RNA standard. The RNA standard was calibrated using a plasmid (2019-nCoV_N; IDT, 10006625) that was quantified using droplet digital PCR. Values were normalized to copies/ml for apical washes or copies/tissue for cell-associated RNA.

RNA was extracted from 25 mg of lung homogenates and tracheal swabs using the innuPREP Virus RNA Kit (Analytik Jena). SARS-CoV-2 RNA copies were quantified using the NEB Luna Universal Probe One-Step RT-qPCR Kit (New England Biolabs) on the StepOnePlus Real-Time PCR System (Thermo Fisher Scientific) as previously described (42 (link)).

RNA was extracted from oropharyngeal swabs and 25 mg homogenized lung tissue using innuPREP Virus DNA/RNA Kit (Analytic Jena, Jena, Germany) according to the manufacturer’s instructions. NEB Luna universal Probe One-Step RT-qPCR Kit (New England Biolabs, Ipswich, MA, United States) was used to perform qPCR with cycling conditions of 10 min at 55°C for reverse transcription, 3 min at 94°C for activation of the enzyme, and 40 cycles of 15 s at 94°C and 30 s at 58°C on a qTower G3 cycler (Analytic Jena, Jena, Germany) in sealed qPCR 96-well plates. To monitor virus growth, SARS-CoV-2 RNA was quantified in cell culture supernatants by RT-qPCR targeting the SARS-CoV-2 E gene, as described previously (Corman et al., 2020 (link)).

To determine virus titers from 50 mg of lung tissue, tissue homogenates were prepared using a bead mill (Analytik Jena, Jena, Germany), and 10-fold serial dilutions were prepared in MEM, which were then added to Vero E6 cells in 12-well plates. The dilutions were removed after 2 h and cells were overlaid with 1.25% microcrystalline cellulose (Avicel, FMC BioPolymer, Hamburg, Germany) in MEM supplemented with 10% FBS and penicillin/streptomycin. Three days later, cells were formalin-fixed, stained with crystal violet and plaques were counted. RNA was extracted from 25 mg of lung homogenates and oropharyngeal swabs using the innuPREP Virus RNA kit (Analytik Jena, Jena, Germany). Viral RNA copies were quantified in 10% of the obtained eluate volume with a one-step RT-qPCR reaction using a standard curve and the NEB Luna Universal Probe One-Step RT-qPCR kit (New England Biolabs, Ipswich, MA, USA) and previously published TaqMan primers and probe (SARS-CoV-2 E_Sarbeco) [20 (link)] on a StepOnePlus RealTime PCR System (Thermo Fisher Scientific, Waltham, MA, USA).