Pcrii topo ta vector

The complete coding sequence (CDS) of SOX5 gene was amplified from a HD B cell cDNA sample as a 3.1 kb PCR fragment using proof-reading Phusion DNA polymerase (New England BioLabs). PCR products were subcloned into the pCRII TOPO TA vector (Life Technologies) according to manufacturer’s instructions.
DNA sequencing was performed by an ABI Prism 377 DNA Sequencer (PE, Applied Biosystems). Sequencing data were analyzed using the DNA Sequencing Analysis software version 3.4 (PE Applied Biosystems) and Sequencer version 3.4.1 (Gene Codes Corporation). Assembly, alignment and analysis of DNA sequences were performed by DNASTAR Lasergene software version 8.0 (DNASTAR, Inc.). Cloning and sequencing primers are provided in the table S1.

The amplified pmrA and pmrB genes from the respective E. coli strains were directly inserted into the pCRII-TOPO TA vector, according to the manufacturer’s protocol (Invitrogen, USA). Since the pCRII-TOPO TA vector is a high-copy-number plasmid that may lead to overexpressed cloned genes, which might constitute a bias in our experiments, wild-type pmrA or pmrB genes from MG1655 were directly inserted into the pCRII-TOPO TA vector as controls in the complementation experiments. The resulting plasmids were separately transformed into identified colistin-resistant strains, E. coli MG1655_ΔpmrA or MG1655_ΔpmrB via electroporation. The transformants were selected by overnight incubation at 37°C on kanamycin (50 mg/liter)-supplemented Mueller-Hinton agar, and the presence of the cloned gene was verified via PCR sequencing. The designations of all E. coli transformants are shown in Table S1.

Primers that cover 80%−100% of X. laevis sulf1 and sulf2 coding regions were designed based on the nucleotide details NM_001097379.1 and NM_001094945.1 respectively from the NCBI database. The 6‐O‐endosulfatase genes were amplified from cDNA reverse transcribed from RNA extracted from stage 38 and 42 X. laevis embryos. PCR products of the respective genes were cloned into pCRIITOPO TA vector (supplied by Invitrogen NZ) and the plasmids were linearized via PCR with the M13 sequencing primers prior to RNA probe synthesis. Digoxigenin labelled RNA probes were synthesized and whole mount in situ hybridization was carried out following procedures previously described by Pownall et al. (1996) with modification for limb samples as in McEwan et al. (2011).
Samples were photographed in phosphate buffer solution (PBS) on 1.5%−2% noble agar using a Leica Fluo III dissecting microscope and accompanying Leica camera and LS software. All figures were processed and compiled in Adobe Photoshop CS5.

Ciona 5-HT receptor sequences were identified by BLAST search on the NCBI (http://www.ncbi.nlm.nih.gov, last accessed on 27 February 2023) and ANISEED (http://www.aniseed.cnrs.fr/, last accessed on 27 February 2023) databases by using as queries different vertebrate sequences encoding for each class of receptors and PCR-amplified from cDNA of C. intestinalis embryos (sequences and primers are listed in the Supplementary Materials, Additional File S1, Tables S1 and S2). The amplicons were sequence verified (Eurofins Genomics, Vimodrone, Milano, Italy) and cloned into a pcRII-TOPO-TA vector (Invitrogen, Carlsbad, CA, USA). The isolated cDNA clones were also used as a template for antisense and sense riboprobes for the in situ hybridization experiments.

The runt-VWRPY⁺ 10,050 bp genomic fragment, was amplified from w¹¹¹⁸ fly genomic DNA using Expand Long Template PCR System (Roche) and cloned into pCR II-TOPO TA vector (Invitrogen). An AvrII site was introduced abutting the runt stop codon. The fragment ends are defined by primers: 5′-GGAAAAGTGTGTGGAAAACGGTGGA and 5′-GCAACCCAAATGTCTTGTGAAATGAA. The runt-VWRPY⁺ construct was modified to runt-∆WRPY and runt-WRPW using PCR to amplification to change the C-terminal amino acids. The entire runt coding sequences, including modifications, were introduced into the genomic clone using an AscI site located in the runt 5′ UTR and the introduced AvrII site and confirmed by DNA sequencing. All Runt domain mutations: Cys-127-Ser and Lys-199-Ala, Arg-80-Ala, Arg-139-Ala, Arg-142-Ala, Arg-174-Ala, Arg-177-Ala mutants were generated in pCR II-TOPO TA vector using QuikChange site directed mutagenesis kit (Agilent). The wild type and the respective modifications were confirmed by DNA sequencing. All constructs were cloned, using vector derived EcoRI sites, in the pattB transformation vector kindly provided by Johannes Bischof, Basler lab, Zurich. Transgenic injections were carried out by Genetic services Inc. MA. Constructs were inserted into fly genomic attP2 site on the third chromosome by targeted φC31 mediated specific insertion (Venken et al. 2006 (link)).

In situ hybridization to detect transcripts in whole embryos was performed as previously described [34 (link)]. The cxcr4a probe was previously described [35 (link)]. To generate all other probes, RNA was extracted from pooled 48 hpf WT embryos using the Qiagen Micro RNeasy kit (Qiagen, 74004). cDNA was produced with the iScript cDNA Synthesis Kit from Bio-Rad (Bio-Rad, 1708890), and the following primers were used to amplify gene-specific cDNA using standard TAQ polymerase. ahr1a: forward primer CGGCATGAGTTTCAGAGACA and reverse primer AAGAGGCAGGATCAGAAGAT, ahr1b: forward primer CCAGAAAGGAGCAGGTACGGATGAAGTTAC and reverse primer GTTGACGGCTGTCTGCGAGAGGG, ahr2: forward primer GATGGAGTCAACTTCTCAGAAGGGGAGC and reverse primer ACTACTAGTATCCATTCCCTCTTGGATGTTCATTC, cyp1a1: forward primer CGGAAACAACCCACATTTGAGTCTGAC and reverse primer CGGTGAACTTTAACCTTTGCAGCAGGAT, cyp1b1: forward primer CGAATGGCTCAGAAATACGGCGAC and reverse primer TGGACCAGCACAGACGTGAAGAGGAA, glut1: forward primer GCAGGAGGAACTCAATGCTC and reverse primer TGGACCAGCACAGACGTGAAGAGGAA. These PCR amplicons were TOPO cloned into the pCRII-TOPO TA vector from Invitrogen (Invitrogen, 450640), and digested/sequenced to determine orientation for antisense probe generation following linearization of the plasmid.

RNA transcripts were synthesized in vitro and used as standards in the development of the RT-qPCR assays essentially as described previously [39 (link)]; basically, PCR products containing the qPCR target sequences were produced by conventional RT-PCR as described above, and cloned into pCRII-TOPO TA vector (Invitrogen). After sequencing verification of the obtained clones, RNA transcripts were synthesized using MEGAscript T7 (Ambion) and SP6 (Roche) Transcription Kits, according to the manufacturer's instructions. Removal of the DNA template from the in vitro transcription reaction was done with TURBO DNase (Ambion) as described in manufacturer’s instructions. Standards were quantified using NanoPhotometerTM P-Class P330 (IMPLEN) and the number of standard copies per nanogram was calculated using the following equation: copies per nanogram = (N_A x A) / (n x mw), where N_A the Avogadro constant (6.02 x 10²³ molecules per mole), A the amount of the standard in g, n the length of the standard in nucleotides, and mw the molecular weight per nucleotide (considering average molecular masses of 340 Da for one nucleotide of single-stranded RNA). All primers used for standards preparation are described in Table 1.