TUG1 siRNA, miR-29a inhibitor, and negative control (NC) were purchased from Guangzhou RiboBio Biotechnology (Guangzhou). IFITM3 siRNA and NC were purchased from Shanghai Gene Pharmaceutical. MHCC-97H and HCC-LM3 cells were divided into the NC and treatment groups. The purchased interference fragments were first subjected to qRT-PCR to verify their effectiveness (Figure S2 ). The interference fragment and inhibitor for each gene were transfected into cells using the Lipofectamine 3000 kit (Invitrogen; Thermo Fisher Scientific, Inc., Waltham, MA, USA). The TUG1 siRNA sequence was as follows: TUG1-s1 sense: 5'-GTTGACCTTGCTGTGAGAA-3' and antisense: 5'-AACCTGGGAACCTTGGATTG-3'; TUG1-s2 sense: 5'-GCACCTGGAACCTCATCTA-3' and antisense: 5'-CATCACTGGCATATCTGCCT-3'; TUG1-s3 sense: 5'- GCCTCTATTCCTGTATGTA-3' and antisense: 5'- ATCTAGGAGTCTGTATACTG-3'. The IFITM3 siRNA sequence was as follows: IFITM3-s1 sense, 5'-CCA UUC UGC UCA UCG UCA UTT-3' and antisense, 5'-AUG ACGAUGAGCAGAAUGGTT-3'; IFTM3‑s2 sense, 5'‑GCUGAUCUU CCAGGCCUAUTT‑3' and antisense, 5'‑AUAGGCCUGGAA GAUCAGCTT‑3'.
Tug1 sirna
Manufactured by RiboBio
Sourced in China
TUG1 siRNA is a small interfering RNA (siRNA) that targets the TUG1 gene. The TUG1 gene is involved in the regulation of cellular processes. The TUG1 siRNA is designed to downregulate the expression of the TUG1 gene, which may be useful for research purposes.
Automatically generated - may contain errors
Lab products found in correlation
Lipofectamine 3000 kit, by Thermo Fisher Scientific (2 mentions)
Mir 29a inhibitor, by RiboBio (2 mentions)
Opti mem medium, by Thermo Fisher Scientific (1 mentions)
Control sirna, by RiboBio (1 mentions)
Ribofect cp reagent, by RiboBio (1 mentions)
Scrambled sirna, by Thermo Fisher Scientific (1 mentions)
Scrambled sirna, by RiboBio (1 mentions)
Lipofectamine 2000 transfection reagent, by Thermo Fisher Scientific (1 mentions)
4 protocols using tug1 sirna
1
Knocking Down TUG1 and IFITM3 in Liver Cancer
2
Manipulating Cell Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cells were seeded in 6‐well or 96‐well culture plates. MUC1 overexpression vectors (pCMV6‐MUC1) or NC, and HOTTIP small interfering RNA (siRNA), TUG1 siRNA, or control siRNA (RiboBio Co.) were transfected by using Lipofectamine 3000 reagent before cells were grown to 60% confluency. Moreover, miR‐4726‐5p mimics were transfected with RiboFect CP reagent (RiboBio) according to the manufacturer's instructions. Briefly, Lipofectamine 3000 and siRNA or overexpressed plasmids were incubated in Opti‐MEM medium (Invitrogen) for 5 min, respectively, then they were mixed gently, the mixture was incubated at room temperature for 15 min, and then added into the cell culture medium. The miRNA mimics were incubated with RiboFect CP Regent, and then added into the cell culture medium. The cells were transfected for 24–72 h according to experimental needs.
3
Silencing TUG1 and p63 in Colon Cancer
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Small interfering RNA that targeted TUG1-RNA (TUG1-siRNA) and p63-RNA (p63-siRNA) and a scrambled negative control (Scrambled-siRNA) were generously provided by the RiboBio Company (Guangzhou, China). Human colon cancer cells HCT-116 and LoVo were transfected with either 50 nM siRNA or Scrambled-siRNA for 24 h using Lipofectamine 2000 transfection reagent according to the manufacturer’s protocol (Life Technologies).
4
Silencing TUG1 and miR-29a in Liver Cancer Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
TUG1 siRNA, miR-29a inhibitor, and negative control (NC) were purchased from Guangzhou RiboBio Biotechnology (Guangzhou). IFITM3 siRNA and NC were purchased from Shanghai Gene Pharmaceutical. MHCC-97H and HCC-LM3 cells were divided into the NC and treatment groups. The interference fragment and inhibitor for each gene were transfected into cells using the Lipofectamine 3000 kit (Invitrogen; Thermo Fisher Scientific, Inc., Waltham, MA, USA). The TUG1 siRNA sequence was as follows: sense, 5' GTTGACCTTGCTGTGAGAA 3' and antisense, 5' AACCTGGGAACCTTGGATTG 3'. The miR-29a inhibitor sequence was as follows: UAACCGAUUUCAGAUGGUGCUA. The IFITM3 siRNA sequence was as follows: IFITM3-s1 sense, 5'-CCA UUC UGC UCA UCG UCA UTT-3' and antisense, 5'-AUG ACG AUG AGC AGA AUG GTT-3'.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!