The total RNA from tomato leaves was extracted with TRIzol Reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions. The first-strand cDNA was synthesized from one microgram of total RNA using a reverse transcriptase system (Thermo, Beijing, China), according to the manufacturer’s instructions. The reactions were performed using the SYBR Mixture (Juheme) with an Applied Biosystems 7500 real-time PCR system (Applied Biosystems). The PCR assays were conducted with the following parameters: 95 °C for 30 s; 40 cycles of 95 °C for 30 s, 60 °C for 15 s, and 72 °C for 15 s. All of the primers that were used in the qRT-PCR analysis are listed in Additional file 4 : Table S4, some of which came from the previous studies [24 (link), 38 (link)–40 (link)]. The tomato Actin2 gene was used as the internal control. The results were calculated using the 2−ΔΔCt method [41 (link)]. All of the qRT-PCR assays were conducted in three biological replicates and each biological replicate had three technical replicates.
Reverse transcriptase system
Manufactured by Thermo Fisher Scientific
Sourced in United States
The Reverse Transcriptase System is a laboratory instrument designed to perform the reverse transcription process. Reverse transcription is a fundamental technique in molecular biology, where RNA is used as a template to synthesize complementary DNA (cDNA) molecules. This system provides the necessary components and tools to facilitate this important step in various research and diagnostic applications.
Automatically generated - may contain errors
Lab products found in correlation
Rpmi 1640 medium, by Thermo Fisher Scientific (2 mentions)
Low glucose dulbecco s modified eagle s medium lg dmem, by Thermo Fisher Scientific (2 mentions)
3 5 3 triiodothyronine t3, by Merck Group (2 mentions)
Goat anti actin, by Santa Cruz Biotechnology (2 mentions)
L glutamine, by Thermo Fisher Scientific (2 mentions)
Tri reagent, by Molecular Research Center (2 mentions)
Fetal bovine serum (fbs), by Thermo Fisher Scientific (2 mentions)
Phosphate buffered saline (pbs), by Thermo Fisher Scientific (2 mentions)
Nerve growth factor (ngf), by Thermo Fisher Scientific (2 mentions)
Activated charcoal, by Thermo Fisher Scientific (2 mentions)
Penicillin streptomycin antibiotic solution, by Thermo Fisher Scientific (2 mentions)
Sybr green pcr master mix, by Thermo Fisher Scientific (2 mentions)
Turbo dna free kit, by Thermo Fisher Scientific (2 mentions)
Ponceau s stain, by Thermo Fisher Scientific (2 mentions)
Dowex ag 1x 10 resin, by Thermo Fisher Scientific (2 mentions)
Cell viability green indicator dye, by Thermo Fisher Scientific (2 mentions)
Free t3 elisa kit, by Biosynth (2 mentions)
Rabbit anti trα β fl 408, by Santa Cruz Biotechnology (2 mentions)
Goat anti amyloid a4, by Santa Cruz Biotechnology (2 mentions)
Neuroscreen 1 ns 1, by American Type Culture Collection (2 mentions)
10 protocols using reverse transcriptase system
1
Quantitative Real-Time PCR Analysis of Tomato Transcripts
2
Neuronal-Like Cell Line Characterization
3
Neuronal-Like Cell Line Characterization
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The rat neuronal-like NeuroScreen 1 (NS-1) and rat hepatic H4IIE cell lines were from American Type Culture Collection (ATCC; Manassas, VA). RPMI 1640 medium, low glucose Dulbecco’s modified Eagle’s medium (LG-DMEM), antibiotic (penicillin/streptomycin) solution, phosphate-buffered saline (PBS), L-glutamine, activated charcoal, Dowex (AG-1X-10) resin, Ponceau S Stain, Cell Viability Green Indicator dye, reverse transcriptase system, fetal bovine serum (FBS), and the SYBR Green PCR Master Mix were purchased from Thermo Scientific (Logan, UT). NGF was from Fisher Scientific (Pittsburg, PA). 3,5,3’-Triiodothyronine (T3) was from Sigma–Aldrich (St. Louis, MO). The free T3 ELISA kit was obtained from Fitzgerald (Acton, MA). TRI Reagent was purchased from Molecular Research Center (Cincinnati, OH). The Turbo DNA-free kit was acquired from Ambion (Austin, TX). Rabbit anti-TRα/β (FL-408; diluted 1:100), goat anti-amyloid A4 (diluted 1:100), and goat anti-actin (diluted 1:250) specific antibodies were obtained from Santa Cruz Biotechnology (Santa Cruz, CA). Rabbit anti-Aβ (diluted 1:100), sheep anti-tau (diluted 1:333), mouse anti-actin (diluted 1:500), anti-rabbit Dylight 680, anti-mouse Dylight 680, anti-sheep Dylight 680, and anti-goat Dylight 800 were from Pierce Thermo Scientific Pierce (Rockford, IL). All other materials used were from Fisher Scientific or Sigma–Aldrich.
4
Quantitative Analysis of PIM1 Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cells (5 × 105) were seeded onto 6-well plates. Total RNA was extracted using TRIzol (Invitrogen, USA) followed by isopropanol precipitation and chloroform extraction. cDNA synthesis was performed using the Reverse Transcriptase System (Invitrogen, USA) according to the manufacturer’s protocol. Real-time PCR (qRT-PCR) was performed with the iCycler Real Time System (Bio-Rad Laboratories, Richmond, CA, USA) using the SYBR Premix EX Tag Master mixture kit (TaKaRa, Japan) according to the manufacturer’s instructions. The sequences of the PIM1 primers were 5′-CTGCTCAAGGACACCGTCTACA-3′ (sense strand) and 5′-GATGGTAGCGGATCCACTCTG-3′ (antisense strand). The sequences of the GAPDH primers were 5′-GGACCTGACCTGCCGTCTAG-3′ (sense strand) and 5′-GTAGCCCAGGATGCCCTTGA-3′ (antisense strand). Relative quantification of PIM1 was performed using the 2−ΔΔCT method normalised to the level of GAPDH.
5
Gene Expression Analysis of Stem Cell Markers
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cells were collected and total RNA was extracted using the RNeasy Total RNA system (Qiagen GmbH, Hilden, Germany) following the manufacturer's protocols. The first-strand cDNA was synthesized using the Reverse Transcriptase System (Invitrogen), and the target cDNAs were amplified using primer pairs for Wnt1, β-catenin, CD44, and Oct4. GAPDH was used as the internal standard. All the reverse transcription primers above were purchased from Applied Biosystems (Carlsbad, CA, USA). The sequences were Wnt1 forward, 5′-CGCTCTCTTCCAGTTCTCAGACAC-3′ and reverse, 5′-CAGGATGGCAAAAGGGTTCG-3′ β-catenin forward, 5′-GCTGATTTGATGGATGGAGTTGG-3′ and reverse, 5′-CTACTTGTTCTTGAGTGAA-3′ CD44 forward, 5′-CTCCGGACACCATGGACAAGT-3′ and reverse, 5′-CTCTTCTTATGCTATA-ACCTG-3′ Oct4 forward, 5′-TGGAGAAGGAGAAGCTGGAGCAAAA-3′ and reverse, 5′-GGCAGATGGTCGTTTGGCTGAATA-3′ and GAPDH forward, 5′-ATGTCGTGGAGTCTACTGGC-3′ and reverse, 5′-TGACCTTGCCCACAGCCTTG-3′.
Aliquots (8 μl) of the amplified products were loaded in the 1.5% agarose gels, separated by electrophoresis, and visualized by ethidium bromide staining.
Aliquots (8 μl) of the amplified products were loaded in the 1.5% agarose gels, separated by electrophoresis, and visualized by ethidium bromide staining.
6
Quantifying TAZ Transcript Levels in Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using TRIzol® (Transgene, China) from parental and transfected HeLa cells, followed by isopropanol precipitation and chloroform extraction. cDNA was synthesized using the Reverse Transcriptase system (Invitrogen; Thermo Fisher Scientific, Inc.), in accordance with the manufacturer’s protocol. RT-PCR was performed using an iCycler™ Real Time system (Bio-Rad Laboratories, Richmond, CA, USA) using the SYBR Premix EX Tag Master mixture kit (Takara Bio, Inc.) according to the manufacturer's protocol. The quantification of gene transcription was normalized to GAPDH mRNA. The primers used in this study were as follows:
TAZ: Primer F 5′ TCATCACCGTGTCCAATC 3′.
Primer R 5′ CTGAAGAAGTGGGAGTGTAG 3′.
GAPDH: Primer F 5′ CACCCACTCCTCCACCTTTG 3′.
Primer R 5′ CCACCACCCTGTTGCTGTAG 3′.
The samples were amplified in different wells and run in triplicate. The relative expression of genes was compared with the 2−ΔΔCt relative quantification method.
TAZ: Primer F 5′ TCATCACCGTGTCCAATC 3′.
Primer R 5′ CTGAAGAAGTGGGAGTGTAG 3′.
GAPDH: Primer F 5′ CACCCACTCCTCCACCTTTG 3′.
Primer R 5′ CCACCACCCTGTTGCTGTAG 3′.
The samples were amplified in different wells and run in triplicate. The relative expression of genes was compared with the 2−ΔΔCt relative quantification method.
7
Quantification of SARS-CoV-2 and HCoV-229E RNA Levels
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from cells with an RNeasy Mini Kit (Qiagen), and first-strand cDNA was generated from total RNA using random primers and a reverse transcriptase system (Invitrogen). Real-time PCR was performed on a Roche Light Cycler 480 system with TaqMan qPCR Master Mix Universal (ABI). The primer and probe sequences used to detect HCoV-229E (N gene CDS for genomic and subgenomic RNA level) and SARS-CoV-2 (NSP14 CDS for genomic RNA level) are shown below.
HCoV-229E-Forward primer: 5′- TGGCACAGGACCCCATAAAG- 3’.
HCoV-229E-Reverse primer: 5′- CAACCCAGACGACACCTTCA- 3’.
HCoV-229E-Probe: FAM 5′- TGCAAAATTTAGAGAGCGTG-3′ BHQ (Patent
SARS2-NSP14- Forward primer: 5′- TGGGGYTTTACRGGTAACCT-3’.
SARS2-NSP14- Reverse primer: 5′- AACRCGCTTAACAAAGCACTC-3′
SARS2-NSP14-Probe: FAM 5′- TAGTTGTGATGCWATCATGACTAG-3′ TAMRA. (Epithelix Sàrl)
8
Quantitative RT-PCR for HRV16 and PIV3
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from cells with a RNeasy Mini Kit (Qiagen), and first-strand cDNA was generated from total RNA using random primers and a reverse transcriptase system (Invitrogen). Real-time PCR was performed on a Roche Light Cycler 480 with Taqman qPCR Master Mix Universal (ABI). The primer and probe sequences for detecting HRV16 are shown below.
Forward primer: 5′- CGCTCAGCTGTTAACCCAACA - 3’.
Reverse primer: 5′- CAGCCACGCAGGCTAGAAC - 3’.
Probe: FAM 5′- TAGAGATTCCCCTCCGGCGACGG -3′ BHQ (Sachs et al., 2011 (link)).
The sequences for detecting PIV3 are shown below.
Forward primer: 5′- TGTTGAGCCTATTTGATACATTTAATGC- 3’.
Reverse primer: 5′- ATGATAGCTCCACCAGCTGATTTT- 3’.
Probe: FAM 5′- CGTAGGCAAGAAAACATAA-3′ BHQ (Hu et al., 2005 (link)).
The cycling conditions were as described previously (Hu et al., 2005 (link); Sachs et al., 2011 (link)). The expression values were normalized to that of hGAPDH (Applied Biosystems, 4333764F).
Forward primer: 5′- CGCTCAGCTGTTAACCCAACA - 3’.
Reverse primer: 5′- CAGCCACGCAGGCTAGAAC - 3’.
Probe: FAM 5′- TAGAGATTCCCCTCCGGCGACGG -3′ BHQ (Sachs et al., 2011 (link)).
The sequences for detecting PIV3 are shown below.
Forward primer: 5′- TGTTGAGCCTATTTGATACATTTAATGC- 3’.
Reverse primer: 5′- ATGATAGCTCCACCAGCTGATTTT- 3’.
Probe: FAM 5′- CGTAGGCAAGAAAACATAA-3′ BHQ (Hu et al., 2005 (link)).
The cycling conditions were as described previously (Hu et al., 2005 (link); Sachs et al., 2011 (link)). The expression values were normalized to that of hGAPDH (Applied Biosystems, 4333764F).
9
Quantification of Thrombin-Induced Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Following the indicated doses and incubation times in culture, mIVD tissues (9 discs, ~10 µg) were collected and total RNA was extracted using an Isogen total RNA assay kit from Nippon Gene (Toyama, Japan) according to the manufacturer’s instructions. Complementary DNA was synthesized from 2 µg of total RNA using the Reverse Transcriptase System from Applied Biosystems (Foster City, CA, USA). Quantitative PCR analysis was performed using the Applied Biosystems ABI 7500 Fast Real-Time PCR System according to the manufacturer’s instructions. Primers and probes for mouse Par1 (Mm00438851_m1), mouse Mcp-1 (Mm00441242_m1), and mouse hypoxanthine phosphoribosyl transferase (Hprt) (Mm01545399_m1) were also purchased from Applied Biosystems. The ratio of gene expression to Hprt expression was calculated, and a relative value of 1.0 was assigned to brain or mIVD tissues that were incubated without thrombin.
10
Quantifying C9orf72 Expression in Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was isolated using Qiagen RNeasy Micro Kit (Cat #74004) according to the manufacturer's instructions. RNA was reverse transcribed to cDNA with oligo(dT) with the Promega Reverse Transcriptase System (Cat # A3500) and analyzed using SYBR Green Master Mix (Applied Biosystems). C9orf72 (Forward- 5′- CAGTGATGTCGACTCTTTG−3′ and Reverse- 5′ AGTAGCTGCTAATAAAGGTGATTTG−3′) expression was normalized to RPL13A (Forward- 5′ CCTGGAGGAGAAGAGGAAAGAGA-3′ and Reverse- 5′ TTGAGGACCTCTGTGTATTTGTCAA-3′) or B2M (Forward- 5′ TGCTGTCTCCATGTTTGATGTATCT-3′ and Reverse- 5′ TCTCTGCTCCCCACCTCTAAGT-3′).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!