Hiscript 2 q rt supermix reagent kit

Manufactured by Vazyme

Sourced in China

Hiscript II Q RT SuperMix reagent kit is a reverse transcription kit designed for real-time quantitative PCR (RT-qPCR) analysis. It provides a one-step solution for reverse transcription and subsequent real-time PCR amplification.

Automatically generated - may contain errors

Lab products found in correlation

Nucleozol kit, by Macherey-Nagel (2 mentions) 96 well pcr plate, by NEST Biotechnology (2 mentions) Trizol, by Thermo Fisher Scientific (2 mentions) Sybr green master mix kit, by Vazyme (1 mentions) Nucleozol, by Macherey-Nagel (1 mentions) Sybr premix ex taq kit, by Takara Bio (1 mentions) Abi prism 7500 real time pcr system, by Thermo Fisher Scientific (1 mentions) Trizol reagent, by Thermo Fisher Scientific (1 mentions) Sybr qpcr master mix, by Vazyme (1 mentions) Sybr green pcr master mix, by Roche (1 mentions) Sybr green pcr master mix, by Vazyme (1 mentions)

Spelling variants of this product

HiScript II Q RT SuperMix (523 citations) HiScript Q RT SuperMix (164 citations) HiScript II Q RT SuperMix kit (87 citations) HiScript Q RT SuperMix kit (34 citations) HiScript II RT SuperMix (16 citations) HiScript II Q RT kit (10 citations) HiScript II RT Reagent Kit (5 citations) HiScript II Q RT SuperMix reagent (4 citations) HiScript II RT SuperMix kit (4 citations) HiScript II Q RT reagent kit (2 citations)

6 protocols using hiscript 2 q rt supermix reagent kit

Evaluating Osteogenic Potential of Nanostructured Scaffolds

Check if the same lab product or an alternative is used in the 5 most similar protocols

To evaluate the osteogenic properties of nanostructured scaffolds incorporated with HA, ATP, and both combined, BMSCs were seeded on nanostructured scaffolds in a 6-well plate. At each timepoint (1, 3, and 7 days), total RNA was extracted using a NucleoZol kit (Macherey-Nagel, Germany) according to the instructions. After that, reverse transcription was carried out to synthesize cDNA using the HiScript II Q RT SuperMix reagent Kit (Vazyme, China). Then, gene amplification was performed using the SYBR Premix Ex Taq-TM Real-time PCR kit (Vazyme, China), and the osteogenesis-related primers (alkaline phosphatase (ALP), osteocalcin (OCN), osteopontin (OPN), Osterix (OSX), and Runt-related factor 2 (Runx2) used in this study are listed in Table 1.Table 1

Primer Sequences Applied to RT–PCR Analysis

Gene	Forward Primer	Reverse Primer
GAPDH	5’-CACCACCAACTGCTTAGC-3’	5’-TTCACCACCTTCTTGATGTC-3’
ALP	5’-GCAGTATGAATTGAATCGGAACAAC-3’	5’-ATGGCCTGGTCCATCTCCAC-3’
OPN	5’-TACGACCATGAGATTGGCAGTGA-3’	5’-TATAGGATCTGGGTGCAGGCTGTAA-3’
Runx2	5’-CTGCAAGCAGTATTTACAACAGAGG-3’	5’-GGCTCACGTCGCTCATCTT-3’
OSX	5’-AGGCCTTTGCCAGTGCCTA-3’	5’-GCCAGATGGAAGCTGTGAAGA-3’

Abbreviations: GAPDH, glyceraldehyde-3-phosphate dehydrogenase; ALP, alkaline phosphatase; OPN, osteopontin; OSX, osterix; Runx2, runt-related transcription factor 2.

Liu J., Wu S., Ma J., Liu C., Dai T., Wu X., Zhao H, & Zhou D. (2022). Polycaprolactone/Gelatin/Hydroxyapatite Electrospun Nanomembrane Materials Incorporated with Different Proportions of Attapulgite Synergistically Promote Bone Formation. International Journal of Nanomedicine, 17, 4087-4103.

+ Open protocol

+ Expand

Osteogenic Gene Expression Analysis in BMSCs

Check if the same lab product or an alternative is used in the 5 most similar protocols

After co-culture with the composite hydrogels for 3 to 14 days, the total RNA of BMSCs was extracted using NucleoZOL (MACHEREY-NAGEL, Germany). Then the first-strand complementary DNA (cDNA) was synthesized from total RNA using a Hiscript II Q RT SuperMix reagent Kit (Vazyme, China) to obtain the reverse transcription mRNA. Finally, real-time PCR of total 10 μL samples in a 96-well PCR plate (Nest Biotechnology, Wuxi, China) was tested using an SYBR Green Master Mix kit (Vazyme, China). To normalize the results, the 2^−ΔΔCt method (Livak’s method) was introduced to quantify the gene expression levels. All samples were analyzed in triplicate. Reverse transcription (RT)-PCR primers of osteogenic genes are shown in Table 1.Table 1

Primer Sequences for Target Genes

Gene	Forward Primer	Reverse Primer
OCN	5-ACCATCTTTCTGCTCACTCTGCT	5-CCTTATTGCCCTCCTGCTTG
OPN	5-TACGACCATGAGATTGGCAGTGA	5-TATAGGATCTGGGTGCAGGCTGTAA
Runx-2	5-CTGCAAGCAGTATTTACAACAGAGG	5-GGCTCACGTCGCTCATCTT
Osterix	5-AGGCCTTTGCCAGTGCCTA	5-GCCAGATGGAAGCTGTGAAGA
GAPDH	5-CACCACCAACTGCTTAGC	5-TTCACCACCTTCTTGATGTC

Abbreviations: OCN, osteocalcin; OPN, osteopontin; OSX, osterix; Runx2, runt-related transcription factor 2; GAPDH, glyceraldehyde-3-phosphate dehydrogenase.

Liu C., Qin W., Wang Y., Ma J., Liu J., Wu S, & Zhao H. (2021). 3D Printed Gelatin/Sodium Alginate Hydrogel Scaffolds Doped with Nano-Attapulgite for Bone Tissue Repair. International Journal of Nanomedicine, 16, 8417-8432.

+ Open protocol

+ Expand

Quantitative Real-Time PCR Analysis of Inflammatory Cytokines

Check if the same lab product or an alternative is used in the 5 most similar protocols

According to the manufacturer's instructions, total RNAs were extracted from A549 cell line or lung tissues with TRIzol reagent (Invitrogen). The cDNA was reverse‐transcribed by using the HiScriptII Q RT SuperMix Reagent Kit (Vazyme, Nanjing, China) for different experiments. Quantitative real‐time PCR was performed with the SYBR Premix EX Taq Kit (Takara, Dalian, China) using an ABI PRISM 7500 Real‐time PCR system (Life Technologies, Waltham, MA), and β‐actin was used as the internal control. The sequences of PCR primers used in this study were shown as follows: IL‐6 forward, 5′‐ACTCACCTCTTCAGAACGAATTG‐3′ and reverse, 5′‐CCATCTTTGGAAGGTTCAGGTTG‐3′; IL‐1β forward, 5′‐ATGATGGCTTATTACAGTGGCAA‐3′ and reverse, 5′‐GTCGGAGATTCGTAGCTGGA‐3′; IL‐12 forward, 5′‐ACCCTGACCATCCAAGTCAAA‐3′ and reverse, 5′‐TTGGCCTCGCATCTTAGAAAG‐3′; TNF‐α forward, 5′‐CCTCTCTCTAATCAGCCCTCTG‐3′ and reverse, 5′‐GAGGACCTGGGAGTAGATGAG‐3′; TGF‐β forward, 5′‐GGCCAGATCCTGTCCAAGC‐3′ and reverse, 5′‐GTGGGTTTCCACCATTAGCAC‐3′; GAPDH forward, 5′‐CTTCAACGACCACTTTGT‐3′ and reverse, 5′‐TGGTCCAGGGGTCTTACT‐3′.

Lin H., Chen M., Gao Y., Wang Z, & Jin F. (2022). Tussilagone protects acute lung injury from PM2.5 via alleviating Hif‐1α/NF‐κB‐mediated inflammatory response. Environmental Toxicology, 37(5), 1198-1210.

+ Open protocol

+ Expand

Quantifying M1/M2 Macrophage Markers

Check if the same lab product or an alternative is used in the 5 most similar protocols

Mice were decapitated after anesthesia, and the brain tissue was separated. In detail, total RNA was isolated from tissues with RNAiso plus and reverse transcribed into cDNA using the HiScriptIIQRT SuperMix reagent kit (R223-01, Vazyme). Finally, the cDNA was quantified by qPCR using a SYBR qPCR Master Mix (Q311-02, Vazyme). The mRNA expression levels were calculated by the 2^-ΔΔCt method after the normalization to the expression of M1 markers (iNOS/IL-1β), M2 markers (CD206/Arg1), or GAPDH. All experiments were performed in triplicate and repeated at least three times. Four mice in each group were used for statistical analysis.

Li L., Li L., Zhang J., Huang S., Liu W., Wang Z., Liang S., Tao J, & Chen L. (2020). Disease Stage-Associated Alterations in Learning and Memory through the Electroacupuncture Modulation of the Cortical Microglial M1/M2 Polarization in Mice with Alzheimer's Disease. Neural Plasticity, 2020, 8836173.

+ Open protocol

+ Expand

Extraction and Quantification of Total RNA from Multiple Myeloma Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA from multiple myeloma cells was extracted with TRIzol (Thermo Fisher Scientific) following the manufacturer’s instructions. Subsequently, reverse transcription of 1 µg RNA into cDNA was carried out using a Hiscript II Q RT SuperMix reagent kit (Vazyme, China). The RT-qPCR assay was then performed with this mixture using SYBR Green PCR Master Mix (Roche Diagnostics, Basel, Switzerland) in a 96-well PCR plate (Nest Biotechnology, Wuxi, China).

Li J., Jia Z., Wang R., Xiao B., Cai Y., Zhu T., Wang W., Zhang X., Fan S., Fan X., Han W, & Lu X. (2024). Activated interferon response from DNA damage in multiple myeloma cells contributes to the chemotherapeutic effects of anthracyclines. Frontiers in Oncology, 14, 1357996.

+ Open protocol

+ Expand

Generating M1 Macrophages from RAW 264.7 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

To produce M1 macrophages, RAW 264.7 cells were seeded onto six-well plates. When the cell density reached 70%–90%, the original media was changed to one containing 200 ng/mL lipopolysaccharide (LPS), and the culture was continued for an additional 8 h. Then, a portion of the cell samples were extracted and Quantitative Real-time Polymerase Chain Reaction (qPCR) analysis was performed according to the manufacturer’s protocol to determine M1-related genes, including those encoding IL-1, IL-6, and NOS2, to confirm the M1 phenotype. mRNA was collected using the NucleoZol kit (Machery-Nagel, Germany). Reverse transcription PCR was performed using the Hiscript II Q RT SuperMix reagent kit (Vazyme, China). SYBR Green PCR Master Mix (Vazyme, China) was employed using qPCR. The 2^−ΔΔCt method was used to measure the expression of the target gene. the qPCR reactions were conducted in triplicate for both the target and the housekeeping gene GAPDH. Using a cell scraper, the remaining cells were removed before the scaffold and 2 × 10⁵ cells per well were seeded in 6-well plates. At 1 and 3 days, cell samples from each group were collected for qPCR analysis. The primer sequences are shown in Supplemental Table S1.

Fan S., Tan Y., Yuan X., Liu C., Wu X., Dai T., Ni S., Wang J., Weng Y, & Zhao H. (2024). Regulation of the immune microenvironment by pioglitazone-loaded polylactic glycolic acid nanosphere composite scaffolds to promote vascularization and bone regeneration. Journal of Tissue Engineering, 15, 20417314241231452.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!