La taq pcr kit

A 2014 bp ‘A-philic’ dsDNA sequence, derived from a 40 bp ‘LilF’ sequence described previously (63 (link)), was synthesized and cloned into a 9276 bp plasmid vector pPIC9K using NotI and EcoRI cloning sites (ThermoFisher Scientific, Inc., Project ID: 15ADFYGC, Construct Name: t1_lowF-seq). The construct was verified by sequencing and the sequence is provided in the Supplementary Figure S1.
A linear 11270 bp dsDNA construct used as a substrate for packaging was prepared by PCR from this plasmid using the following primers: biotin-5′-ATGAGTGACGACTGAATCCGGTGA-3′ (forward) (IDT, Inc.) and digoxygenin-5′-GGTTGTATTGATGTTGGACGAGTCGGAA-3′ (reverse) (Eurofins Genomics, Inc.) using the LA Taq PCR kit (TaKaRa, Inc.). The biotin label is used to tether the DNA to streptavidin coated microspheres. The digoxygenin label was used for control experiments in which the DNA alone, in the absence of the prohead–motor complex, is tethered to anti-digoxygenin coated microspheres as described previously (64 (link)).
The 20049 bp dsDNA ‘control’ non-A-philic construct with 51.8% GC content, used in control experiments, was prepared by PCR from lambda phage DNA (NEB, Inc.) using primers Biotin-5′-CTGATGAGTTCGTGTCCGTACAACTGGCGTAATC-3′ (forward) (IDT, Inc.) and digoxygenin-5′-GTGCACCATGCAACATGAATAACAGTGGGTTATC-3′ (reverse) (Eurofins Genomics, Inc.) with the LA Taq PCR kit (TaKaRa, Inc.).

A 2.4 kb of human NQO1 promoter was obtained from the genomic DNA of BEAS-2B cells by the LA Taq PCR Kit (Takara) using primer pair GGCTTCTCAGACCACTCCTG and ACTAGGCTCTCGGTGAGCTG and subcloned into the pGL4.13 luciferase expression plasmid (Promega) between the SacI and XhoI sites. A-1221C mutation (rs689455) at the NQO1 promoter region of the pGL4-NQO1 plasmid was introduced by site-directed mutagenesis PCR using primer pair AGGTCGGGAGTTGGAAAC and CAGGTGATCCTACCGCCT. These two plasmids were named pGL4-NQO1 and pGL4-_SNPNQO1.
To obtain the NQO1 expression plasmid pCD-NQO1, total RNA was extracted from BEAS-2B cells and subjected to reverse transcription using the SuperScript III First-Strand Synthesis System (Invitrogen). The open reading frame and the 3′-UTR of human NQO1 were obtained as one piece by the subsequent PCR (Takara) using primer pair CAGCTCACCGAGAGCCTAGT and AAAAACCACCAGTGCCAGTC and then subcloned between the NheI and XhoI sites of the pcDNA3.1(+) mammalian expression plasmid (Invitrogen). It was named pCMV-NQO1. The CMV promoter in pCD-NQO1 was replaced by the 2.4 kb wild-type or SNP-human NQO1 promoter, which was excised from pGL4-NQO1 and pGL4-_SNPNQO1. The two new plasmids were named pNQO1-NQO1 and p_SNPNQO1 (or pSNP). The correct sequence of each plasmid was verified by DNA sequencing.

Primer pairs were designed to amplify the attachment site-containing regions of the excised and circularized forms of each CTn and MTn (we refer to attachment sites on CTns and MTns as ‘attTn’ in this manuscript) and the attB regions of each cast-off genome (Supplementary Table S2). PCR amplification was performed with 100 ng of genomic DNA and an LA Taq PCR kit (Takara Bio, Otsu, Japan) according to the manufacturer's instructions using the following temperature program: 94°C for 1 min and 30 cycles of 94°C for 20 s, 55°C for 30 s, and 68°C for 2 min. The amplified fragments were subjected to direct sequencing on an ABI PRISM 3130xl sequencer to determine the nucleotide sequences of the attTn- or attB-flanking regions.