Geneart site directed mutagenesis plus kit
The GeneArt® Site-Directed Mutagenesis PLUS Kit is a tool designed to efficiently introduce specific mutations into DNA sequences. It provides a simple and reliable method for generating site-directed mutations in plasmid DNA.
Lab products found in correlation
11 protocols using geneart site directed mutagenesis plus kit
Site-Directed Mutagenesis of F13A Plasmid
Spastin Phosphorylation Site Mutagenesis
P53 Mutant Plasmid Transfection
Construction of FXIII-A Variant Plasmids
One Shot TOP10 competent cells (Invitrogen) were used to expand plasmids. Bacterial media and ampicillin for selection were from Sigma-Aldrich (St Louis, MO, USA). Kits for DNA and plasmid purification were from Invitrogen and Qiagen (Hilden, Germany). Microsynth provided sequencing services.
Generating Zebrafish IKK1 Fusion Constructs
Expression and Characterization of Tubulin Mutants
Site-Directed Mutagenesis of Hoxb13 Phosphorylation Sites
Hoxb13_S204A_F: GCGTTTGCAGAGCCCGCCGTCCAGCACCCTCCT
Hoxb13_S204A_R: AGGAGGGTGCTGGACGGCGGGCTCTGCAAACGC
Hoxb13_S204D_F: GCGTTTGCAGAGCCCGACGTCCAGCACCCTCCT
Hoxb13_S204D_R: AGGAGGGTGCTGGACGTCGGGCTCTGCAAACGC
Hoxb13_S204E_F: GCGTTTGCAGAGCCCGAGGTCCAGCACCCTCCT
Hoxb13_S204E_R: AGGAGGGTGCTGGACCTCGGGCTCTGCAAACGC
Site-Directed Mutagenesis of Hoxb13 Phosphorylation Sites
Engineered HEV-3ra Mutants for Functional Studies
One Shot MAX Efficiency DH5α-T1R competent cells (Invitrogen-Thermo Fischer, Waltham, MA, USA) were transformed with each of the HEV-3ra constructs containing specific mutation(s). The transformed cells were cultured in 50 mL lysogeny broth medium with ampicillin, and plasmid midipreps were performed with Qiagen Plasmid Plus midikit (Qiagen, Germantown, MD, USA). The entire viral genome in each of the HEV-3ra constructs was confirmed through Sanger sequencing to ensure that no additional nucleotide substitution had been introduced.
Validation of miR-29b-1/a Binding Site
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!