pLKO.1 human SIRT2 shRNA was generated as AAGTAGTGACAGATGGTTGGC. pLKO.1 human and mouse PKM2 shRNA were generated as CATCTACCACTTGCAATTA and GTGCACTCCACTTCTGTCACT, respectively. pCMV5-Flag-SIRT2 was generated by standard PCR amplification of SIRT2 followed by cloning into the pCMV5-Flag (Sigma). The human SIRT2 and PKM2 genes were cloned into PCDH-CMV vectors (Lentiviral vector, System Biosciences; CD513B-1). Plasmids encoding Flag (DYKDDDDK)-tagged PKM2 (Open Biosystems) were purified and subjected to site-directed mutagenesis (BioInnovatise). WT amino acids (K62 and K305) were either converted to arginine (R) or glutamine (Q). Functionally inactive SIRT2 was created by conversion of H187 (Addgene) to tyrosine (Y).
Park S.H., Ozden O., Liu G., Song H.Y., Zhu Y., Yan Y., Zou X., Kang H.J., Jiang H., Principe D.R., Cha Y.I., Roh M., Vassilopoulos A, & Gius D. (2016). SIRT2-mediated deacetylation and tetramerization of pyruvate kinase directs glycolysis and tumor growth. Cancer research, 76(13), 3802-3812.
+ Open protocol