Abi 7500 fast

RNA extraction was performed according to the same methods as RNA-Seq. A Prime Script RT Reagent Kit (Takara, Dalian, China) was used to synthesize the cDNA of each sample. Gene-specific primers were designed by Primer3¹ and the elongation factor 1B (Arahy.E3HYWR) was used as an internal control (Supplementary Table 1). qPCR was performed on the ABI 7500 Fast using three replicates and TB Green^® Premix Ex TaqTM (Takara, Dalian, China). The reaction conditions were: 95°C for 5 min, 40 thermal cycles of 95°C for the 30 s, then 60°C for 30 s. The 2−△△CT method was used for relative quantification analysis (Livak and Schmittgen, 2001 (link)). Significance analysis was performed using SPSS 26.0 software.

RNAs extraction and RT-PCR assays were performed as previously [31 (link)]. Total RNA was extracted using Trizol (Invitrogen, Carlsbad, CA, USA) and the RNA was converted into cDNA using the PrimeScript™ RT reagent Kit (Takara Bio Inc, Shiga, Japan) via the first-strand synthesis system (Thermo Scientific, USA). RT-PCR was performed following the standard protocol on ABI 7500fast with SYBR Premix Ex Taq reagent kit (Takara Bio Inc, Shiga, Japan). The sequences of the RT-PCR primers were as follows: IRE1a sense: CACAGTGACGCTTCCTGAAAC, antisense: GCCATCATTAGGATCTGGGAGA; GAPDH sense:GGAGCGAGATCCCTCCAAAAT, antisense: GGCTGTTGTCATACTTCTCATGG.