Seq agencourt

Total DNA was extracted from fresh fungal cultures growing in liquid Sabouraud medium (Merck, Darmstadt, Germany) using the Maxwell 16 Cell SEV kit (Promega, USA). The PCR amplifying the SQLE gene was done as described by Yamada et al. [17 (link)]. Purification of PCR products was then performed using the Exosap IT technique (Amersham, GE Healthcare Europe GmbH, Belgium). Bidirectional sequence data were generated after purification using the BigDye terminator sequencing kit (Applied Biosystems, Life Technologies, Merelbeke, Belgium). Sequenced products were finally purified using the kit clean Seq Agencourt (Beckman Coulter Life Science, Villepinte, France). The sequencing was done on the automate ABI 3500/3500XL (Applied Biosystems, Life Technologies, Belgium). Sequences were edited using the ABI Sequence Scanner V.1.0 software (Applied Biosystems, Life Technologies, Merelbeke, Belgium). Forward and reverse sequences generated by the software were then blasted, and the consensus alignment was transduced in Expasy portal (SIB Bioinformatics Resource Portal, Lausanne, Switzerland) on amino acid sequence. The delivery sequence was then compared to the reference SQLE amino-acid sequence of T. mentagrophytes GenBank: BAL48859.1.

The rRNA ITS2 region was amplified using the ITS86 forward primer 5′GTGAATCATCGAATCTTTGAA 3′ and ITS4 reverse primer 5′TCCTCCGCTTATTGATATGC 3′ [10 (link)]. PCR was done on a classical thermocycler (Thermo Hybaid, Thermo Scientific). Purification of PCR products was then performed using the Exosap IT technique (Amersham, GE Healthcare Europe GmbH, Belgium). Bidirectional sequence data were generated after purification using the BigDye terminator sequencing kit (Applied Biosystems, Life Technologies, Belgium). Sequenced products were finally purified using the kit clean Seq Agencourt (Beckman Coulter Life Science). The sequencing was done on the automate ABI 3500/3500XL (Applied Biosystem, Life Technologies). Sequences were edited using the ABI Sequence Scanner V.1.0 software (Applied Biosystems, Life Technologies). Sequences generated by the software were then compared to the CBS database by using BIOLOMICSNET software (http://www.cbs.knaw.nl/collections/BioloMICSSequences.aspx), which comprises several databases including Genbank. Only results that repeated the same identification at least three times and had a similarity score greater than 95% were considered valid.