Total RNA was isolated from the MC3T3-E1 pre-osteoblasts seeded at 1 × 105 cells/disc coated with OCP without/with κ-carrageenan after 1, 14, and 21 days of culture using an Invitrogen RNA isolation kit (Invitrogen). cDNA synthesis was performed using 0.5–1 μg total RNA in 20 μl reaction mix consisting of 5 units Transcriptor Reverse Transcriptases (Roche Diagnostics, Basel, Switzerland), 1 mM of each dNTP (Invitrogen), 0.08 A260 units random primers (Roche Diagnostics), and 1x concentrated Transcriptor Reverse Transcriptase reaction buffer (Roche Diagnostics). Real-time PCR (RT-PCR) reactions were performed using the LightCycler® 480 SYBR green I Master reaction mix according to the manufacturer’s instructions (Roche Diagnostics) in a Light Cycler 480 (Roche Diagnostics), and relative housekeeping gene expression (PBGD) and relative target gene expression, i.e. runt-related transcription factor 2 (Runx2), osteocalcin (Ocn), fibroblast growth factor 2 (Fgf2), dentin matrix protein 1 (Dmp1), and osteopontin (Opn) were determined. Primers (Invitrogen) used for RT-PCR are listed in Table 1 . Values of target gene expression were normalized for PBGD gene expression.
Lightcycler 480 sybr green 1 master reaction mix
Manufactured by Roche
Sourced in Switzerland
The LightCycler 480 SYBR Green I Master reaction mix is a ready-to-use solution for real-time PCR amplification and detection using the SYBR Green I dye. It contains all the necessary components, including DNA polymerase, nucleotides, and SYBR Green I dye, for efficient and reliable quantification of target DNA sequences.
Automatically generated - may contain errors
Lab products found in correlation
Rneasy mini kit, by Qiagen (6 mentions)
Iscript cdna synthesis kit, by Bio-Rad (5 mentions)
Lightcycler 480 2, by Roche (4 mentions)
Lightcycler 480, by Roche (3 mentions)
Lightcycler 480 real time pcr machine, by Roche (3 mentions)
Verso cdna kit, by Thermo Fisher Scientific (3 mentions)
Trizol, by Thermo Fisher Scientific (3 mentions)
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (3 mentions)
Random primer, by Roche (2 mentions)
Rna isolation kit, by Thermo Fisher Scientific (2 mentions)
Transcriptor reverse transcriptase, by Roche (2 mentions)
Rneasy micro kit, by Qiagen (2 mentions)
Mastercycler realplex2, by Eppendorf (2 mentions)
Nanodrop 1000 spectrophotometer, by Thermo Fisher Scientific (2 mentions)
Trizol reagent, by Thermo Fisher Scientific (2 mentions)
Revertaid first strand cdna synthesis kit, by Thermo Fisher Scientific (2 mentions)
Transcriptor reverse transcriptase reaction buffer, by Roche (1 mentions)
Realplex, by Eppendorf (1 mentions)
M mlv reverse transcriptase, by Thermo Fisher Scientific (1 mentions)
Hiscript 2 q rt supermix, by Vazyme (1 mentions)
23 protocols using lightcycler 480 sybr green 1 master reaction mix
1
Osteogenic Gene Expression in MC3T3-E1 Cells
2
Quantitative PCR analysis of cDNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was extracted from larvae or cells to generate RNA for cDNA production as previously described15 (link). In total, 20 ng of cDNA samples were run in triplicate with LightCycler® 480 SYBR Green I Master reaction mix (Roche) using the primers listed in Supplementary Table 1 . Reactions were run on the Roche LightCycler® 480 Real-Time PCR Machine. CT values for each sample set were normalised against the housekeeper genes, before comparing the data sets.
3
Quantitative RT-PCR Evaluation of Gene Expression
4
Quantitative Real-Time PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from whole liver tissue or cultured cells was isolated using Trizol® (#15596026, Life Technologies, Carlsbad, CA), according to the manufacturer's instructions, or using the RNA Mini Kit (#IB47303, IBI Scientific, Dubuque, IO). RNA was reverse-transcribed using the iScript™ cDNA synthesis kit (#1708890, BioRad) according to the manufacturer's protocol. Quantitative real-time PCR (qPCR) was performed using the LightCycler®480 SYBR Green I Master reaction mix (#04707516001, Roche) on a LightCycler®480 II (Roche), and data were evaluated using the LightCycler® 480 software. Details of the qPCR primers are listed in Table S2 . Melting curve analysis was performed to exclude non-specific reactions or contaminations. All real-time samples were run in duplicates. Gene expression was determined by the 2−ΔΔCt method and normalized to the expression levels of the gene encoding ribosomal protein S18 (Rps18).
5
Brain Tumor Tissue RNA Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA (1 μg) extracted from brain tumor tissue was used to synthesize cDNA using M-MLV reverse transcriptase (Invitrogen). Real-time PCR assays were performed using a LightCycler 480 SYBR Green I Master reaction mix (Roche Molecular Systems, Pleasanton, CA, USA) and the following gene-specific primers: transmembrane protein 119 (TMEM119) sense 5′-GCCTCCTCATCCTTCTGTTG-3′ and antisense 5′-TATCCCATCCAGGAAGTTGG-3′ follistatin (FST), sense 5′-GTTTTCTGTCCAGGCAGCTCCAC-3′ and antisense 5′-GCAAGATCCGGAGTGCTTTACT-3′ R-spondin 3 (RSPO3), sense 5′-AATACATCGGCAGCCAAAACGCC-3′ and antisense 5′-TGTCAAGGCACTTTCCAAGGTG-3′ proto-oncogene tyrosine-protein kinase ROS (ROS1), sense 5′-GGTGACAGTGCTTATAAACG-3′ and antisense 5′-AAGGTTGGAATGAGCTGGATA-3′ neuroblastoma 1 (NBL1), sense 5′-CCAAGTCCATCCAGAACAGG-3′ and antisense 5′-CTCAGCCCCCTCTTCCTCT-3′ and glyceraldehyde 3-phosphate dehydrogenase (GAPDH), sense 5′-ACCACAGTCCATGCCATCAC-3′ and antisense 5′-TCCACCACCCTGTTGCTGTA-3′.
6
Quantitative RT-PCR for Muscular Dystrophy Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was extracted from larvae or cells using a Trizol protocol. A total of 5 μg of RNA was mixed with 10 mM dNTP mix and 250 ng of random primers and heated to 65 °C for 5 min. The reaction was cooled on ice for a minute and added first strand buffer, 0.1 M DTT, RNaseH Recombinant RNase inhibitor (40 units/μl) and incubated at 50 °C for 1 h. The reaction was inactivated by a 70 °C incubation for 15 min. cDNA concentration was gauged on a nanodrop and 20 ng cDNA samples were run in triplicate with LightCycler® 480 SYBR Green I Master reaction mix (Roche) and primers as below. Reactions were run using the Roche LightCycler® 480 Real-Time PCR Machine. CT values for each sample set were normalised against the housekeeper genes, before comparing the datasets. Dmd: Forward (F) CAGTAGAGAGGGAACACCGC, Reverse (R) ATCTCGCCTCCCAGAAAACG. Dmd2: F GATTCGCCCCCAAAACAACA, R GTTCTCCCTCATCTCGCCTC. Housekeeping genes. βactin: F CGAGCTGTCTTCCCATCC, R TCACCAACGTAGCTGTCTTTCTG. zrp113a: F TCTGGAGGACTGTAAGAGGTATG, R AGACGCACAATCTTGAGAGCAG. Ef1α: F GCTGGCAAGGTCACAAAGTC, R GAACACGCCGCAACCTTTG.
7
Plant RNA Extraction and RT-qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA of plant material was extracted using the Plant Total RNA Purification Kit (GeneMark, Taiwan, China) followed by cDNA synthesis with HiScript II Q RT SuperMix (Vazyme, Nanjing, China). RT-qPCR was performed with a LightCycler 480 instrument using the LightCycler 480 SYBR Green I Master Reaction Mix (Roche, Shanghai, China). The reaction conditions were as follow: (1) 95 °C for 5 min; (2) 45 cycles: 95 °C for 20 s, 55 °C for 20 s, 72 °C for 40 s; (3) 95 °C for 5 s, 60 °C for 60 s and 95 °C for 10 s. RNAs were extracted in triplicate (three biological replicates) and each corresponding cDNA was amplified three times (three technical replicates). Medicago elongation factor was used as a reference gene. The Ct values were obtained with the help of the LightCycler 480 software. Primers used for RT-qPCR are shown in Supplementary Table 2
8
Quantification of Zebrafish ace2 and Immune Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
cDNA was obtained from the zebrafish samples, as described above. The LightCycler 480 SYBR Green I master reaction mix (04707516001; Roche Diagnostics [HK] Ltd., Hong Kong, SAR) was used to determine the mRNA expression levels of ace2 and the immune or inflammatory response genes ifnphi1, ccl20a.3, and il1b. The reactions were performed in a LightCycler 480 II instrument (Roche Diagnostics [HK] Ltd.) using the default SYBR green program, and the gene expression levels were quantified using the cycle threshold (ΔΔCT) method and presented as fold change (2−ΔΔCT) with β-actin as the internal control. The expression of ace2 was measured relative to the 2-dpf group, whereas the expression of ifnphi1, ccl20a.3, and il1b was measured relative to the solvent control group. The primers used for the RT-qPCR are listed in Table 1 .
9
Quantifying GANP Gene Expression in U-2 OS Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
U-2 OS cells were transfected using siRNAs for 72 h. RNA was purified using the RNeasy Mini Kit (Qiagen, #74104) according to the manufacturer’s protocol. Reverse transcription of total RNA to cDNA was performed using High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems, #4368814) according to the manufacturer’s protocol. LightCycler 480 SYBR Green I Master reaction mix (Roche, #04707516001) was used for the real-time PCR using the LightCycler 96 Instrument (Roche, #05815916001) according to the manufacturer’s protocol. Relative quantification analysis was used to compare the target gene of interest (GANP) and the reference gene (GAPDH) and to express the final result as a ratio of these genes. LightCycler 96 software (Roche, version 1.1.0.1320) was used for the analysis following the LightCycler 96 System User Training Guide V2.0.
10
RNA Isolation and RT-qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Isolation of total RNA was performed using the RNeasy Mini kit (Qiagen).
RNA was reverse transcribed using the iScript™ cDNA synthesis kit (#1708890, Bio-Rad, Hercules, CA), according to the manufacturer’s protocol. RT-qPCR was performed using the LightCycler®480 SYBR Green I Master reaction mix (Roche) in a LightCycler®480 II (Roche), and data were evaluated using the LightCycler® 480 software. Melting curve analysis was performed to exclude non-specific reactions or contaminations. All real-time samples were run in duplicates. Gene expression was determined by the 2-ΔΔCt method. Gapdh was used for normalization of the expression levels of mouse genes. Primer sequences are listed inTable S3 .
RNA was reverse transcribed using the iScript™ cDNA synthesis kit (#1708890, Bio-Rad, Hercules, CA), according to the manufacturer’s protocol. RT-qPCR was performed using the LightCycler®480 SYBR Green I Master reaction mix (Roche) in a LightCycler®480 II (Roche), and data were evaluated using the LightCycler® 480 software. Melting curve analysis was performed to exclude non-specific reactions or contaminations. All real-time samples were run in duplicates. Gene expression was determined by the 2-ΔΔCt method. Gapdh was used for normalization of the expression levels of mouse genes. Primer sequences are listed in
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!