High capacity cdna archive kit

Manufactured by Thermo Fisher Scientific

Sourced in United States, United Kingdom, Germany, Italy, France, Japan, Spain, Belgium, Canada, Poland

The High-Capacity cDNA Archive Kit is a laboratory product designed for the efficient conversion of RNA into complementary DNA (cDNA). It provides a high-capacity, reliable, and reproducible method for generating cDNA archives suitable for various downstream applications.

Automatically generated - may contain errors

Lab products found in correlation

Spelling variants of this product

High Capacity cDNA kit (436 citations) High Capacity Kit (98 citations) CDNA archive kit (59 citations) High Capacity Archive Kit (14 citations) Applied Biosystems High Capacity cDNA Archive Kit (6 citations) High-capacity cDNA archive kit protocol (5 citations) High-Capacity cDNA Archive (4 citations) High Capacity cDNA Archive RT kit (4 citations) CDNA kits (3 citations) High-Capacity cDNA Archive Kit reagents (2 citations)

1 061 protocols using high capacity cdna archive kit

Quantifying HIV-1 gRNA Stability

Check if the same lab product or an alternative is used in the 5 most similar protocols

Hela cells were washed with 1xPBS and the RNA was extracted using the RNeasy kit (Qiagen) following the manufacturer’s instructions. 1 μg of RNA was reverse transcribed to cDNA using the High Capacity cDNA archive kit (Applied Biosystems). RNA from virions was isolated using QIAamp viral RNA mini kit following the manufacturer’s instructions. Because carrier RNA is added to the lysis buffer, the total RNA isolated was quantified using a Qubit 3.0 fluorometer (ThermoFisher) and normalized so that 20 ng of RNA from each sample was reverse transcribed using the High Capacity cDNA archive kit (Applied Biosystems). PCR reactions were performed in triplicate with Taqman Universal PCR mix using the Applied Biosystems 7500 real-time PCR system. HIV-1_NL4-3 gRNA primers were GGCCAGGGAATTTTCTTCAGA/TTGTCTCTTCCCCAAACCTGA (forward/reverse) and the probe was FAM-ACCAGAGCCAACAGCCCCACCAGA-TAMRA. HIV-1_NL4-3 total RNA primers were TAACTAGGGAACCCACTGC/GCTAGAGATTTTCCACACTG (forward/reverse) and the probe was FAM-ACACAACAGACGGGCACACACTA-TAMRA. To analyze gRNA stability, 1 µg/ml Actinomycin D (Sigma Aldrich) was added to HeLa cells ~ 45 h post-transfection. RNA was isolated at the designated timepoints and gRNA abundance was measured.

Antzin-Anduetza I., Mahiet C., Granger L.A., Odendall C, & Swanson C.M. (2017). Increasing the CpG dinucleotide abundance in the HIV-1 genomic RNA inhibits viral replication. Retrovirology, 14, 49.

+ Open protocol

+ Expand

Quantification of Murine Gastric Cytokine Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA from stomachs of C3H/HeN mice was prepared using the High Pure RNA Tissue Kit according to the recommendations of the manufacturer (Roche, USA). For cytokine mRNA quantification, 5 μg of total RNA was converted into cDNA using a high capacity cDNA archive kit (Invitrogen). Levels of interleukin IL-1β, IL-6, IL-18, IL-10, IL-23, IL-17, tumor necrosis factor alpha (TNF –α), TGF-β, and FoxP3 mRNA were measured by Q-PCR using TaqMan gene expression assays for use in the A CFX Connect™ Real-Time PCR Detection System (Bio-Rad). Transcript levels were normalized to those of mRNA of the endogenous control glyceraldehyde-3-phosphate dehydrogenase (GAPDH), and expressed as the fold change compared to samples from control mice using the Comparative CT method (Bio-Rad).

Narayana J.L., Huang H.N., Wu C.J, & Chen J.Y. (2015). Efficacy of the antimicrobial peptide TP4 against Helicobacter pylori infection: in vitro membrane perturbation via micellization and in vivo suppression of host immune responses in a mouse model. Oncotarget, 6(15), 12936-12954.

+ Open protocol

+ Expand

RNA Extraction and RT-PCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Samples were homogenized in Tri reagent (Sigma-Aldrich, St. Louis, MO, USA) using a TissueLyser (Qiagen) with autoclaved metal beads (Qiagen). RNA concentration and purity were measured with a NanoDrop spectrophotometer (Thermo Fisher Scientific, Bioscience, Waltham, MA, USA), and RNA quality was checked using an Agilent 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA, USA). For RT-PCR, cDNA was synthesized from the isolated RNA using a High Capacity cDNA Archive Kit (Invitrogen, Life Technologies, Carlsbad, CA, USA).

Kapitány A., Medgyesi B., Jenei A., Somogyi O., Szabó L., Gáspár K., Méhes G., Hendrik Z., Dócs K., Szücs P., Dajnoki Z, & Szegedi A. (2021). Regional Differences in the Permeability Barrier of the Skin—Implications in Acantholytic Skin Diseases. International Journal of Molecular Sciences, 22(19), 10428.

+ Open protocol

+ Expand

Analyzing β Cell Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA from β cells were obtained using the RNAeasy Micro and Mini kits (Qiagen). cDNA was synthesized from the RNA by reverse transcription using the High Capacity cDNA Archive Kit (Invitrogen) and analyzed by QuantStudio 6 Flex Real-Time PCR Systems (Invitrogen) according to the DeltaDelta Ct method. Expression levels were normalized to Ribosomal Protein S18 (Rps18). Primer sequences are shown in Supplementary Table 6.

Mankin A.S., Zyrianova I.M., Kagramanova V.K, & Garrett R.A. (1992). Introducing mutations into the single-copy chromosomal 23S rRNA gene of the archaeon Halobacterium halobium by using an rRNA operon-based transformation system.. Proceedings of the National Academy of Sciences of the United States of America, 89(14), 6535-6539.

+ Open protocol

+ Expand

RNA Isolation and RT-qPCR Quantification

Check if the same lab product or an alternative is used in the 5 most similar protocols

One microgram of RNA was isolated using Trizol (Invitrogen, Paisley, UK) and reverse-transcribed with the High Capacity cDNA Archive Kit. Real-time PCR was performed on a ABI Prism 7500 PCR system with pre-developed primer and probe assays (Applied Biosystems, Foster City, CA, USA) using the DeltaDelta Ct method. Expression levels are given as ratios to GAPDH [18 (link)].

Cuarental L., Valiño-Rivas L., Mendonça L., Saleem M., Mezzano S., Sanz A.B., Ortiz A, & Sanchez-Niño M.D. (2020). Tacrolimus Prevents TWEAK-Induced PLA2R Expression in Cultured Human Podocytes. Journal of Clinical Medicine, 9(7), 2178.

+ Open protocol

+ Expand

Quantifying H19 and miR-342-3p Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNAs from PFMCs and CD4+ T cells were extracted by Trizol (Invitrogen, USA), and inversely transcribed into cDNA using the High-Capacity cDNA archive kit (Invitrogen, USA). qRT-PCR was conducted to measure H19 and miR-342-3p expression using PowerUp™ SYBR™ Green Master Mix (Invitrogen, USA). The relative expressions of H19 and miR-342-3p were expressed as a function of threshold cycle (Ct) and analyzed by 2^−ΔΔCt method. Specific primers for H19 and miR-342-3p were as follows: H19, F: 5′-GCTCCACTGACCTTCTAAAC-3′; miR-342-3p, F: 5′-UCUCACACAGAAAUCGCACCCGU-3′.

Liu Z., Liu L., Zhong Y., Cai M., Gao J., Tan C., Han X., Guo R, & Han L. (2019). LncRNA H19 over-expression inhibited Th17 cell differentiation to relieve endometriosis through miR-342-3p/IER3 pathway. Cell & Bioscience, 9, 84.

+ Open protocol

+ Expand

RNA Extraction and cDNA Synthesis

Check if the same lab product or an alternative is used in the 5 most similar protocols

All samples were homogenized in TriReagent solution (Sigma‐Aldrich, Dorset, UK) with Tissue Lyser (QIAGEN) using previously autoclaved metal beads (QIAGEN). Total RNA was isolated from the biopsies. RNA concentrations and purities were measured using a NanoDrop spectrophotometer (Thermo Scientific, Bioscience, Budapest, Hungary). RNA quality was checked using an Agilent 2100 Bioanalyser. Samples were treated with DNase I (Applied Biosystems, Foster City, CA, USA). RNA was reverse transcribed into complementary DNA (cDNA) using the High Capacity cDNA Archive Kit (Invitrogen, Life Technologies, San Francisco, CA, USA), according to the manufacturer’s instructions.

Dajnoki Z., Somogyi O., Medgyesi B., Jenei A., Szabó L., Gáspár K., Hendrik Z., Gergely P., Imre D., Póliska S., Törőcsik D., Zouboulis C.C., Prens E.P., Kapitány A, & Szegedi A. (2021). Primary alterations during the development of hidradenitis suppurativa. Journal of the European Academy of Dermatology and Venereology, 36(3), 462-471.

+ Open protocol

+ Expand

Gene Expression Analysis by qRT-PCR

Check if the same lab product or an alternative is used in the 5 most similar protocols

For gene expression analysis, total RNA was isolated by using TRIzol reagent (Invitrogen, Thermo Fisher Scientific, Waltham, MA, USA) according to the manufacturer’s protocol. Then, 2.5 µg of total RNA was reverse transcribed into cDNA by using the High-Capacity cDNA Archive Kit (Invitrogen, Thermo Fisher Scientific, Waltham, MA, USA). qRT-PCR was performed using the ABI Prism 7500 instrument (Applied Biosystem, Thermo Fisher Scientific, Waltham, MA, USA). cDNA amplification was assessed using a specific primer reported by Marzolla et al. [20 (link)] (UCP1, Adbr3, Cidea, DIO2, Cpt1beta, Cpt2, Crat, ACADM, ACADL, Hadha, Aco2, Idh3a Sdhac, Cs), and PowerUp SYBR green dye (Invitrogen, Thermo Fisher Scientific, Waltham, MA, USA) according to the manufacturer’s protocol. All samples were normalized using TATA-box binding protein (TBP) as an internal control; the relative quantification was calculated using the comparative ΔΔCT method, and the values were expressed as 2^−ΔΔCT.

Pacifici F., Malatesta G., Mammi C., Pastore D., Marzolla V., Ricordi C., Chiereghin F., Infante M., Donadel G., Curcio F., Noce A., Rovella V., Lauro D., Tesauro M., Di Daniele N., Garaci E., Caprio M, & Della-Morte D. (2023). A Novel Mix of Polyphenols and Micronutrients Reduces Adipogenesis and Promotes White Adipose Tissue Browning via UCP1 Expression and AMPK Activation. Cells, 12(5), 714.

+ Open protocol

+ Expand

RNA Extraction and Quantitative PCR

Check if the same lab product or an alternative is used in the 5 most similar protocols

Fly and fibroblast RNA were extracted with a Quick-RNA MiniPrep (Genesee Scientific, San Diego, CA, USA, Cat #: 11-328) according to the protocol provided by the manufacturer. Fruit flies were homogenized at 3 cycles at 4000 rpm with 30 s of rest in between cycles with a BeadBug-6 homogenizer using 800 uL of DNA/RNA shield solution (Cat. No. R1100-250) in premade tubes containing 2.0 mm bashing beads provided by Zymo Research (Cat. No. S6003-50). Subsequent RNA extraction was done according to the Quick-RNA MiniPrep plus protocol from Zymo Research (Cat. No. R1051). The cDNA was prepared using reverse transcription of total RNA with a High-Capacity cDNA Archive Kit (Applied Biosystems, Foster City, CA, USA, Cat. No. 4368814). Q-PCR was performed with an ABI 7500 Fast thermocycler (Applied Biosystems, Foster City, CA, USA ) following protocols provided by the manufacturer. qPCRBio Sygreen Mix was used for qPCR according to the protocol provided by the manufacturer (Cat. No. PB20. 11-20). Technical triplicates were processed for each biological replicate.

Yuan Y., Van Belkum M., O’Brien A., Garcia A., Troncoso K., Elshikha A.S., Zhou L, & Song S. (2022). Human Alpha 1 Antitrypsin Suppresses NF-κB Activity and Extends Lifespan in Adult Drosophila. Biomolecules, 12(10), 1347.

+ Open protocol

+ Expand

Transcriptomic Profiling and Validation

Cited 2 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

For each sample, RNA was extracted using the QIAGEN Micro RNeasy kit Plus. cDNA was synthesized and amplified using the Ovation Pico WTA System, labeled using the Encore Biotin module and loaded on an Affymetrix GeneChip® HT HG-U133⁺ PM Array Plate which is designed to assess expression levels of transcripts in the human genome. Transcriptome profiling was performed using two successive batches of cDNA synthesized from each cohort.
Differentially expressed transcripts (DETs) detected by microarray were assessed by qPCR as previously described^{19 (link),21 (link)} using the cDNA template obtained from cohort 1 samples. Transcripts selected for validation had a differential expression between subject groups >20% and a high level of expression (Robust Multi-array Average (RMA) normalized value >7). Primer sets were designed outside of the Affymetrix target except when precluded by the small size of some transcripts (Supplemental Table 2). Selected DETs were also assessed by qPCR in grey matter homogenates of DLPFC area 9; for these samples, total RNA was converted to cDNA using the High Capacity cDNA Archive Kit from Applied Biosystems (Foster City, CA). Primer set efficiencies and normalizers for qPCR are described in Supplemental Methods and Supplemental Table 2.

Arion D., Corradi J.P., Tang S., Datta D., Boothe F., He A., Cacace A.M., Zaczek R., Albright C.F., Tseng G, & Lewis D.A. (2015). Distinctive transcriptome alterations of prefrontal pyramidal neurons in schizophrenia and schizoaffective disorder. Molecular psychiatry, 20(11), 1397-1405.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!