Extract n amp tissue pcr kit

Manufactured by Merck Group

Sourced in United States, Germany

The Extract-N-Amp™ Tissue PCR Kit is a laboratory product designed for rapid extraction and amplification of DNA from various tissue samples. The kit provides a streamlined workflow for efficient DNA isolation and subsequent polymerase chain reaction (PCR) analysis.

Automatically generated - may contain errors

Lab products found in correlation

Axio observer z1, by Zeiss (6 mentions) Revertaid first strand cdna synthesis kit, by Thermo Fisher Scientific (4 mentions) Dnase 1, by Thermo Fisher Scientific (4 mentions) In fusion cloning, by Takara Bio (2 mentions) Wild type c57bl 6j male mice, by Jackson ImmunoResearch (2 mentions) Sybr premix ex taq 2, by Takara Bio (2 mentions) Generuler dna ladder mix, by Thermo Fisher Scientific (1 mentions) Qiaquick pcr purification kit, by Qiagen (1 mentions) Primer express 3, by Thermo Fisher Scientific (1 mentions) Taqman mgb probe, by Thermo Fisher Scientific (1 mentions) Streptozotocin (stz), by Merck Group (1 mentions) Redextract n amp pcr readymix, by Merck Group (1 mentions) Compozr zfn, by Merck Group (1 mentions) Exosap it, by Thermo Fisher Scientific (1 mentions) Sequencher version 5, by Gene Codes (1 mentions) Gelred nucleic acid gel stain, by Biotium (1 mentions) Caerulein, by Merck Group (1 mentions) Picopump, by World Precision Instruments (1 mentions) Pcr2.1 topo, by Thermo Fisher Scientific (1 mentions) Gentra puregene blood kit, by Qiagen (1 mentions)

47 protocols using extract n amp tissue pcr kit

Genetically Engineered Mouse Models for Pancreatic Cancer

Check if the same lab product or an alternative is used in the 5 most similar protocols

KC mice (LSL-Kras^G12D/+; Pdx-1-Cre) on a C57BL/6 background were obtained by interbreeding male LSL-Kras^G12D/+; Pdx-1-Cre and female Pdx-1-Cre mice. Genomic DNA was extracted from tail snips using the Extract-N-Amp tissue PCR kit (Sigma) and genotyped [29 (link),48 (link)]. Four week-old KC mice were randomized and fed powered 5002 rodent chow. Nine week-old KC mice were treated with INCB057643 (10 mg/kg). INCB057643 was dissolved in 5% (v/v) DMSO and then added to a solution of 10% tween in saline and administered by gavage. Cearulein were administered by intraperitoneal injection, and the pancreas, spleen and blood were collected 24 h after the last INCB057643 administration. Cearulein (Sigma) was administered at 75 μg/kg every hour for 8 h for 2 consecutive days, with an overnight rest.
KPC mice (LSL-Kras^G12D/+; LSL-Trp53^R172H/+; Pdx-1-Cre) on a C57BL/6 background were obtained by interbreeding male LSL-Kras^G12D/+; Pdx-1-Cre and female Trp53^R172H/+; Pdx-1-Cre mice. Genomic DNA was extracted from tail snips using the Extract-N-Amp tissue PCR kit (Sigma) and genotyped. Four week-old KPC mice were randomized and fed powered 5002 rodent chow and monitored for disease. Monitoring was done by palpating the abdominal cavity for abnormal growths twice a week after 16 weeks of age; the presence of tumors was confirmed by ultrasound.

Leal A.S., Liu P., Krieger-Burke T., Ruggeri B, & Liby K.T. (2020). The Bromodomain Inhibitor, INCB057643, Targets Both Cancer Cells and the Tumor Microenvironment in Two Preclinical Models of Pancreatic Cancer. Cancers, 13(1), 96.

+ Open protocol

+ Expand

Genotyping by PCR for Fpr2 Alleles

Check if the same lab product or an alternative is used in the 5 most similar protocols

Fpr2 WT and humanized alleles and Cre were detected by polymerase chain reaction (PCR) (online suppl. Fig. S4a, b). DNA from the ear clips was extracted using an Extract-N-Amp Tissue PCR Kit (Merck Life Science UK Limited). Primers were purchased from Merck Life Science UK Limited (online suppl. Table S1). PCR amplification was conducted using REDExtract-N-Amp™ PCR ReadyMix™ (Merck Life Science UK Limited). The amplified samples were run on 3.5% agarose gel with GeneRuler DNA Ladder Mix (Thermo Fisher Scientific) at 100 voltage.

Chen J., Austin-Williams S., O'Riordan C.E., Claria-Ribas P., Sugimoto M.A., Norling L.V., Thiemermann C, & Perretti M. (2023). Formyl Peptide Receptor Type 2 Deficiency in Myeloid Cells Amplifies Sepsis-Induced Cardiac Dysfunction. Journal of Innate Immunity, 15(1), 548-561.

+ Open protocol

+ Expand

Genomic DNA Extraction and Sequencing

Check if the same lab product or an alternative is used in the 5 most similar protocols

Genomic DNA was extracted from leaves of stable transgenic transformants using Extract-N-Amp™ Tissue PCR kit (Merck, Germany) according to the manufacturer’s protocol. PCR was performed using primers (Supplementary Table S2) flanking the targeted regions. The PCR products were purified using QIAquick PCR purification kit (QIAGEN, Germany) and the amplicons were sequenced by Sanger sequencing (Genewiz, United Kingdom). The results were analyzed using the Synthego ICE analysis tool. If the sequencing results were ambiguous, the PCR products were cloned in pTOPO from the Zero Blunt^® TOPO^® PCR Cloning Kit (Thermo Fisher Scientific, United States) and 5–10 clones were sequenced individually for each sample.

Göritzer K., Grandits M., Grünwald-Gruber C., Figl R., Mercx S., Navarre C., Ma J.K, & Teh A.Y. (2022). Engineering the N-glycosylation pathway of Nicotiana tabacum for molecular pharming using CRISPR/Cas9. Frontiers in Plant Science, 13, 1003065.

+ Open protocol

+ Expand

Ant Sample Collection and COI Sequencing

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Ants were manually collected from 35 nests throughout northeastern Argentina. Identification was done up to morphospecies, since updated keys for Nylanderia species are not available for the studied region, resulting in: 30, 2, 2 and 1 samples of N. fulva, Nylanderia sp. 1, Nylanderia sp. 2 and P. longicornis, respectively (Table S1). Genomic DNA was extracted from a single worker ant per nest using Extract-N-Amp Tissue PCR kit (Sigma-Aldrich Inc., St. Louis, MO, USA). Ant cytochrome C oxidase subunit I (COI) gene fragments were amplified by PCR using Jerry and Pat primer pair (18 (link)) and sequencing was performed by Macrogen (Macrogen Inc., Seoul, South Korea).

Fernández M.B., Bleidorn C, & Calcaterra L.A. (2022). Wolbachia Infection in Native Populations of the Invasive Tawny Crazy Ant Nylanderia fulva. Frontiers in Insect Science, 2, 905803.

+ Open protocol

+ Expand

Slc26a4 Knockout Mouse Generation

Check if the same lab product or an alternative is used in the 5 most similar protocols

Timed-pregnant wild type (WT) CD-1 mice were purchased from Japan SLC Inc. (Shizuoka, Japan), and original 129 Sv/Ev strain Slc26a4 knockout (Slc26a4^−/−) mice were generated by NIH^{26 (link)} (by Dr. Eric Green). The Slc26a4^−/− on 129 Sv/Ev background mice was backcrossed with WT mice on a CD-1 background until 3^rd generation. 3^rd generation Slc26a4^+/− mice were maintained by crossbreeding Slc26a4^+/− mice × Slc26a4^+/− mice or Slc26a4^+/− mice × Slc26a4^−/− mice. Noon on the day on which a vaginal plug was detected was designated as E 0.5 of development. E 11.5 timed-pregnant Slc26a4^+/− mice, which were crossbred with male Slc26a4^−/− mice or male Slc26a4^+/− mice were used for EUGO experiments. Treated pups were genotyped at the same point as morphological assessments were performed, utilizing the Extract-N-Amp™ Tissue PCR Kit (Sigma, St. Louis, MO). Primers for genotyping of Slc26a4 mutants were: TGCCGATTTCATCGCTGG, GCATTGTAGTTCTTTTCCAAGTTGG and GGGTGCGGAGAAAGAGGTAATG.

Takeda H., Miwa T., Kim M.Y., Choi B.Y., Orita Y, & Minoda R. (2019). Prenatal electroporation-mediated gene transfer restores Slc26a4 knock-out mouse hearing and vestibular function. Scientific Reports, 9, 17979.

+ Open protocol

+ Expand

CRISPR-Mediated THIK-1 Gene Disruption

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

The THIK‐1 gene (kcnk13) was disrupted by MRC Harwell by using CRISPR/Cas9 to insert a single nucleotide into the wild‐type DNA sequence (Bradley et al., 2012 (link); Brown & Moore, 2012 (link); Pettitt et al., 2009 (link)). Insertion resulted in a frameshift mutation in the codon of for amino acid 14. This resulted in a premature stop codon after amino acid 68. The mice were maintained as homozygotes on a C57BL/6 background. To confirm the genotype of the mice Taqman MGB Allelic Discrimination genotyping assays were designed using Primer Express 3.0.1 (Applied Biosystems). Taqman MGB probes were purchased from ThermoFisher & primers were purchased from Sigma Aldrich.

Primer/probe name	Sequence (5′–3′)
MmKCNK13 SNP genotyping FP	GGTCGGCAGAGCACATCCT
MmKCNK13 SNP genotyping RP	CTGCAACTCCTGCGCTAGCT
MmKCNK13 WT SNP genotyping probe	FAM‐CACCTGAACGAGGAC‐MGB
MmKCNK13 KO SNP genotyping probe	VIC‐CACCTGAATCGAGGAC‐MGB

Lysates were prepared from ear snips using Extract‐N‐Amp Tissue PCR Kit from Sigma (XNAT2R). qPCR was run in 384 plates with the following thermocycler conditions: 60°C × 30 s, 95°C × 10 min, then 40 cycles at 95°C × 15 s, 60°C × 1 min, lastly one cycle at 60°C × 30 s.

Drinkall S., Lawrence C.B., Ossola B., Russell S., Bender C., Brice N.B., Dawson L.A., Harte M, & Brough D. (2022). The two pore potassium channel THIK‐1 regulates NLRP3 inflammasome activation. Glia, 70(7), 1301-1316.

+ Open protocol

+ Expand

Generating msps Gene-Edited Drosophila Line

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Two small gRNA (#1-GGGGTATTTCAATCAGAAGC; #2- ACGGGAAGCGCACAGTTTAT) targeting msps enomic region were synthesized and inserted into the pCFD5 vector (74 (link)) (Addgene, Plasmid #73914) via BbsI digestion. 6XMS2 were amplified from the pSL-MS2–6X (Addgene, plasmid #27118) (75 (link)) and inserted into the pScarlessHD-C-3xVHH05-DsRed (Addgene, Plasmid #171580) (63 ) via InFusion cloning (Takara Bio) to create the vector of pScarlessHD-C-3xVHH05–6XMS2-DsRed. ~1 kb 5’ homology arm and ~1 kb 3’ homology arm of msps genomic region were amplified from the genomic DNA (Sigma, Extract-N-Amp™ Tissue PCR Kit), mutated to be insensitive to gRNAs, and inserted into the pScarlessHD-C-3xVHH05–6XMS2-DsRed vector via InFusion cloning (Takara Bio). The DNA plasmid of pScarlessHD-5’ msps homology arm-C-3xVHH05–6XMS2-DsRed-3’ msps homology arm was co-injected with pCFD5-gRNA#1 and pCFD5-gRNA#2 by BestGene. Flies with fluorescent red eyes were selected and crossed with Tub-PBac flies to remove the DsRed region by PBac transposase. The final msps-3XVHH05–6XMS2 line was verified using genomic PCR amplification and sequencing.

Lu W., Lakonishok M, & Gelfand V.I. (2023). Drosophila oocyte specification is maintained by the dynamic duo of microtubule polymerase Mini spindles/XMAP215 and dynein. bioRxiv.

+ Open protocol

+ Expand

DNA Extraction and Sequencing Protocol

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

DNA extraction was performed directly from 96% ethanol-preserved liver tissue, using the Extract-N-Amp™ Tissue PCR Kit (Sigma-Aldrich, Merck KGaA, Darmstadt, Germany), followed by PCR reactions under the manufacturer’s protocol [7 (link)]. Genomic extraction, amplification, and sequencing are as described in Székely et al. [7 (link)]. The newly generated DNA sequences (12S, 16S and RAG-1) were deposited in GenBank (S1 Table).

Székely P., Székely D., Ordóñez-Delgado L., Armijos-Ojeda D, & Vörös J. (2021). Our unknown neighbor: A new species of rain frog of the genus Pristimantis (Amphibia: Anura: Strabomantidae) from the city of Loja, southern Ecuador. PLoS ONE, 16(10), e0258454.

+ Open protocol

+ Expand

PCR Genotyping of Lrp2 Mutant Alleles

Check if the same lab product or an alternative is used in the 5 most similar protocols

PCR genotyping was performed on embryonic yolk sac DNA or tail DNA using the Extract-N-Amp™ Tissue PCR Kit (Sigma-Aldrich, Zwijndrecht, The Netherlands), following the standard manufacturer protocol. The wild-type allele was amplified by the primer Lrp2-E+T-F (G21)+Lrp2-E-R (G20) (Table S1), producing a 361-bp fragment. Detection of the mutant allele was performed using the primers Lrp2-E+T-F (G21)+Lrp2-T-R (BPA) (Table S1), resulting in a 300-bp product.

Baardman M.E., Zwier M.V., Wisse L.J., Gittenberger-de Groot A.C., Kerstjens-Frederikse W.S., Hofstra R.M., Jurdzinski A., Hierck B.P., Jongbloed M.R., Berger R.M., Plösch T, & DeRuiter M.C. (2016). Common arterial trunk and ventricular non-compaction in Lrp2 knockout mice indicate a crucial role of LRP2 in cardiac development. Disease Models & Mechanisms, 9(4), 413-425.

+ Open protocol

+ Expand

Generation of Ubqln Knockout Mice

Check if the same lab product or an alternative is used in the 5 most similar protocols

A cassette containing floxed exon 2 of the murine Ubqln1 gene was inserted into C57BL/6 ES cells by homologous recombination and selected with neomycin resistance. Following selection, neo resistance was removed via FRT recombination and exon two deleted via transient Cre expression. ES cells lacking exon 2 of Ubqln1 were then used to generate knockout mice. Ubqln2^−/− and Ubqln4^−/− mouse models were generated in a fashion similar to Ubqln1^−/− mice by floxing exon 1 of Ubqln2 and exons 2 and 3 of Ubqln4 in the C57BL/6 backgrounds. Mice were genotyped using small tail clippings and the Sigma Extract-N-Amp tissue PCR kit. Ubqln1^−/− mice were housed according to IACUC guidelines and all experiments were performed according to IACUC standards and under protocol numbers TH16-0169, 15–2041, 15–3110, 16–1851, and 16–2557. For tissue collection, mice were euthanized with CO₂ according to IACUC guidelines, followed by cervical dislocation. All mice were at least 8 weeks of age for experiments.

Whiteley A.M., Prado M.A., Peng I., Abbas A.R., Haley B., Paulo J.A., Reichelt M., Katakam A., Sagolla M., Modrusan Z., Lee D.Y., Roose-Girma M., Kirkpatrick D.S., McKenzie B.S., Gygi S.P., Finley D, & Brown E.J. (2017). Ubiquilin1 promotes antigen-receptor mediated proliferation by eliminating mislocalized mitochondrial proteins. eLife, 6, e26435.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!