FG-4592 was obtained from either Selleckchem or MedChemExpress. Cyclohexamide was purchased from Abcam. siRNAs were obtained from Thermo Fisher Scientific, MG132 and 4-thiouridine, and N-ethylmaleimide were purchased from Sigma-Aldrich. Primary antibodies used in this study are ALKBH5 (Atlas Antibodies), β Actin (Sigma), HIF-1α (BD Bioscience), HIF-2α (NOVUS), HIF-1β (NOVUS), NDRG1 (CST), HBc (DAKO), anti-m6A polyclonal antibody (Synaptic Systems). HRP-conjugated secondary antibodies were purchased from DAKO.
4 thiouridine
Manufactured by Merck Group
Sourced in United States, Germany, United Kingdom
4-thiouridine is a nucleoside analog that contains a sulfur atom substituted for the oxygen atom at the 4-position of the uracil ring. It is commonly used as a chemical reagent in various applications, including the study of RNA structure and function.
Automatically generated - may contain errors
Lab products found in correlation
Trizol, by Thermo Fisher Scientific (8 mentions)
Biotin hpdp, by Thermo Fisher Scientific (5 mentions)
Ez link hpdp biotin, by Thermo Fisher Scientific (4 mentions)
μmacs streptavidin kit, by Miltenyi Biotec (3 mentions)
4 thiouracil, by Merck Group (3 mentions)
Trizol reagent, by Thermo Fisher Scientific (3 mentions)
Snake venom phosphodiesterase, by Worthington (2 mentions)
Bacterial alkaline phosphatase, by Worthington (2 mentions)
Uridine, by Merck Group (2 mentions)
Lc 18 t, by Merck Group (2 mentions)
Agilent 1100 hplc, by Agilent Technologies (2 mentions)
Protease inhibitor cocktail, by Roche (2 mentions)
N n dimethylformamide (dmf), by Thermo Fisher Scientific (2 mentions)
Protease inhibitor cocktail, by Merck Group (2 mentions)
Dynabeads myone streptavidin c1, by Thermo Fisher Scientific (2 mentions)
Umacs streptavidin kit, by Miltenyi Biotec (2 mentions)
Dithiothreitol (dtt), by Thermo Fisher Scientific (2 mentions)
Nanodrop, by Thermo Fisher Scientific (2 mentions)
Hrp conjugated secondary antibody, by Agilent Technologies (1 mentions)
Fg 4592, by Selleck Chemicals (1 mentions)
45 protocols using 4 thiouridine
1
Comprehensive Cellular Protein Regulation
2
Metabolic Labeling and Purification of Newly Transcribed RNAs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Metabolic labeling was performed as previously described44 (link),45 (link). Briefly, cells were treated with 200 µM 4-thiouridine (4sU, Sigma) for 1 hour followed by phenol-chloroform RNA extraction. 80 µg of RNA was incubated with biotin-HPDP (Thermo) to specifically biotinylate the newly transcribed 4sU labeled RNAs. Biotinylated RNAs were then pulled down using the μMacs Streptavidin Kit (Miltenyi) and at least 100 ng of pulled RNA was used for reverse transcription and downstream qPCR analysis. This experiment was performed once with two biological replicates.
3
4-Thiouridine RNA Labeling Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
If not indicated otherwise, carboxyamidomethylation was performed under standard conditions (50% DMSO, 10 mM iodoacetamide, 50 mM sodiumphosphate buffer pH8, for 15 min at 50°C) using either 1 mM 4-thiouracil (Sigma), 800 µM 4-thiouridine (Sigma), or 5 – 50 µg total RNA prepared from s4U metabolic labeling experiments. The reaction was quenched by addition of excess DTT.
4
Transient siRNA Knockdown in HEK293 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
HEK293 cells were grown in DMEM GlutaMax (Invitrogen) supplemented with 10% FCS (FCS Superior, Biochrom KG) and 1% penicillin/streptomycin solution (Invitrogen) at 37°C with 5% CO2. Cells were split into six-well plates and transfected with 50 pmol siRNAs and 5 µL of Lipofectamine RNAiMax (Invitrogen) per well 1–3 d later, depending on their initial density, at ∼50%–90% confluency (day 1). The following siRNAs were used: siCtrl (UGGGCGUCGUGGAGGCUUUTT, Eurofins MWG Operon), siPABPN1_b (GGAGCUACAGAACGAGGUATT, Eurofins MWG Operon), and siPABPN1_8 (CCCAAAGGGUUUGCGUAUAUA, Qiagen #SI04763577). After 4–6 h incubation, the cells were split to three or four wells. On day 3, the siRNA treatment was repeated. Cells derived from one original well were combined and spread on a 6-cm or 10-cm dish for protein or RNA preparation, respectively. For 4-thiouridine (4-sU) labeling, the medium was renewed on day 4. On day 5 (∼96 h after the first transfection), cells were treated for 10 or 30 min with 500 µM 4-thiouridine (Sigma-Aldrich) or not. Total RNA was isolated by a modified TRIzol method (Chomczynski and Mackey 1995 (link)).
5
Quantitative Analysis of 4SU-Labeled RNA
6
PAR-CLIP Protocol for Crosslinked RNA-Protein Complexes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
PAR-CLIP was performed as previously described (Hafner et al. 2010 (link)) with minor modifications. Briefly, a total of 400 million cells were used for each experiment. Each plate was treated with 4-Thiouridine (Sigma-Aldrich) at a final concentration of 100 µM 14 h prior to UV-crosslinking with 0.15 J/cm2 of 365-nm UV light with a Stratalinker UV Crosslinker (Stratagene). Cells were then scraped, lysed, and digested with RNase T1 (Fermentas) to a final concentration of 1 unit/µL. AGO immunoprecipitation of the lysate was then performed using Dynabeads Protein G magnetic particles (Invitrogen) and AGO antibody (Sigma) at a final concentration of 0.05 µg/µL. A second RNase T1 treatment was then performed using a final concentration of 10 units/µL. The RNA segments were then radiolabeled using 32P-γATP to a final concentration of 0.5 µCi/µL and T4 PNK to a final concentration of 1 unit/µL, and samples were then resuspended in 70 µL SDS-PAGE loading buffer, and SDS-PAGE was performed. The gel bands corresponding to AGO were cut for each sample and electroelution of the crosslinked RNA–protein complexes was then performed. Recovery of crosslinked target RNA fragments was then performed using phenol chloroform and ethanol extraction.
7
Pulse-chase analysis of 4sU-labeled RNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
MCF7 cells silenced for SMUG1 or treated with control siRNAs (72 h) were pulsed for three hours with 4-thiouridine (4sU, Sigma) at a final concentration of 150 μM. After 3 h, media was changed in normal DMEM High Glucose and cell pellets collected at different time points (up to 12 h).
8
Identifying MYC Expression via METTL3 Immunoprecipitation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
GC cells were allowed to react with 200 mm 4-thiouridine (Sigma-Aldrich Chemical Company, St Louis, MO, USA) for 14 h and cross-linked with 0.4 J/cm2 at 365 nm. After lysis, the specific antibody to METTL3 was supplemented to facilitate immunoprecipitation at 4°C. The precipitated RNA was probed with [g-32-P]-ATP and observed by means of autoradiography, followed by proteinase K digestion. The RNA content was extracted and RT-qPCR was employed to determine the expression pattern of MYC [33 (link)].
9
4-Thiouridine RNA Labeling Protocol
10
Evaluating Protein-RNA Interactions via UV Cross-Linking
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To evaluate protein-RNA interactions, HCT116 cells were incubated with 100 μM 4-thiouridine (Sigma) 14 h prior to cross-linking. The cells were washed once with PBS, placed on ice, and irradiated uncovered with 0.15 J/cm2 of 365-nm UV light. Cells were harvested in lysis buffer (50 mM HEPES pH 7.5, 150 mM KCl, 2 mM EDTA, 1 mM NaF, 0.5% NP-40, 0.5 mM DTT, 0.125% SDS) supplemented with protease inhibitor cocktail (Roche) and 0.5 U/μl of RNasin (Promega). Cell lysates were immunoprecipitated using 2 μg of either anti-Sam68 antibodies (07-415, Millipore) or IgG (Santa Cruz), and complexes captured using protein A/G beads (Sigma). The immunoprecipitates were treated with 1 mg/ml of proteinase K in proteinase K buffer (100 mM Tris pH 7.5, 50 mM NaCl, 10 mM EDTA) for 30 min at 55°C. The bound RNA was isolated using TRIzol reagent (Invitrogen) as per the manufacturer's protocol. RT-qPCR was carried out as described above.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!