Transscript first strand cdna synthesis supermix

To detect PB2 and NP mRNA: Total RNA was prepared. Then, according to the manufacturer's instructions, the TransScript First‐Strand cDNA Synthesis SuperMix (Transgen, Beijing, China) was used to reverse transcribe 0.4 μg total RNA into cDNA. Oligo(dT) was used as primers. The cDNA was then used to measure the expression of PB2 and NP mRNA. The level of gapdh mRNA acted as a control.
To detect miRNAs: The cellular expression level of miRNAs was determined by preparing total RNA, and then reverse transcribing 0.4 μg of it into cDNA, by means of the TransScript First‐Strand cDNA Synthesis SuperMix (Transgen); the protocol suggested by the manufacturer was followed. Primers for cDNA synthesis and real‐time PCR were purchased from Ribobio. U6 RNA acted as a control.
TransStart Green qPCR SuperMix (Transgen) was used for real‐time PCRs. The cycling conditions were 95°C for 30 sec., then 40 cycles at 95°C for 10 sec. and at 60°C for 30 sec. After 1 min. at 95°C and 1 min. at 55°C, the melt curve was determined from 55°C to 95°C, with 10 sec. at each 0.5°C interval. The Bio‐RAD IQ5 detection system was used for real‐time PCR. Data were analysed using the 2^−▵▵Ct method 31.

Small RNAs of RAW264.7 cells and PMs were purified and enriched with the miRNA Isolation Kit (Qiagen, Germany. Cat. No. 157046581). Reverse transcription was performed with TransScript First-Strand cDNA Synthesis Supermix (TransGene, Beijing, China, Cat. No. AT301-03). qPCR of miR-100 was performed with probes designed and synthesized by ABI (has-miR-100, 000437). The total RNA of RAW cells was extracted with trizol reagent. Reverse transcription was performed using TransScript First-Strand cDNA Synthesis Supermix, and real-time PCR was performed with TransScript Top Green qPCR supermix (TransGene, Cat. No. AQ-141-04) in triplicate.

Total RNA was prepared from liver tissues and L02 cells with trizol reagent (Invitrogen) and the cDNA was synthesized using TransScript TM First‐Strand cDNA Synthesis Super‐Mix (TransGen Biotech, AT301). Quantitative real‐time PCR was performed using the SYBR^®Pre‐mix Ex TaqTMkit (Takara, RR420A) and analyzed in a step‐one plus RT‐PCR system (life science, Applied Biosystems). The primer sequences of rat IL‐1β, TNF‐α, and IL‐6 were referenced (Song et al., 2016 (link)). The primer sequences of rat MCP‐1 were 5′‐GGCCTGTTGTTCACAGTTGCT‐3′ (sense) and 5′‐TCTCACTTGGTTCTGGTC CAGT‐3′ (antisense); The primer sequences of rat β‐actin were 5′‐CGTTGACATCCGTAAAGACC‐3′ (sense) and 5′‐GCTAGGAGCCAGGGCAGTA‐3′ (antisense). The primer sequences of human IL‐1β, TNF‐α, and IL‐6 were referenced (Sun et al., 2000 (link)). The primer sequences of human MCP‐1 were 5′‐CAGATGCAATCAATGCCCCAGT‐3′ (sense) and 5′‐ATAAAA CAGGGTGTCTGGGGAAAGC‐3′ (antisense). The primer sequences of human β‐actin were 5′‐CGTACCACTGGCATCGTGAT‐3′ (sense) and 5′‐GTGTTGGCGTACAGGTCTTTG ‐3′ (antisense). Relative mRNA expression of genes was calculated using 2^−∆∆CT method.