Evo m mlv rt premix

Total RNA was extracted from clinical specimens using an RNA extraction kit (Accurate Biology, AG21017). Evo M-MLV RT Premix (Accurate Biology, AG11706) and SYBR Premix Ex TaqTM (Accurate Biology, AG11702) were used to prepare samples for RT-qPCR, which was conducted using a Rotor-Gene Q instrument (Qiagen, Germany). We calculated the relative expression levels of target genes based on the 2^-ΔΔCT method. The primers used were as follows: human β-actin Forward: 5’– GGCACCCAGCACAATGAA–3’; human β-actin Reverse: 5’– TAGAAGCATTTGCGGTGG–3’; human GPX4 Forward: 5’– ATCGACGGGCACATGGTTAA–3’; human GPX4 Reverse: 5’– CAGGATCCGCAAACCACACT–3’.

The total RNA was extracted from the NPCs using RNAiso (Takara, Kyoto, Japan). According to the manufacturer’s protocol, reverse-transcribed (RT) complementary DNA (cDNA) was synthesized with the Evo M-MLV RT Premix (Accurate Biology, Changsha, China). For qRT-PCR, a CFX96 Touch™ Real-Time PCR Detection System (BIO-RAD, Hercules, CA, USA) was used in conjunction with 2x SYBR Green qPCR Master Mix (Selleck, Houston, TX, USA). To quantify miR-302c expression, an RT reaction and qPCR were performed using a miDETECTA Track™ Uni-RT Primer and a miDETECTA Track™ miRNA qRT-PCR Starter kit (RiboBio, Guangzhou, China). GAPDH and U6 served as controls for mRNA and miRNA levels, respectively. The 2^−ΔΔCT method was used to calculate the relative expression levels. The primer sequences are listed in Table 2.

Total RNA was extracted by AG RNA Pro Reagent (Catalog: AG21101, Accurate Biology). According to the kit instructions, cDNA was reverse transcription by Evo-M-MLV RT Premix (Catalog: AG11706, Accurate Biology). The qRT-PCR reactions were prepared with SYBR Green Premix Pro TaqHS qPCR Kit (Catalog: AG11739, Accurate Biology). The qPCR primers were shown in Additional file 11: Table S2.

From 2019 to 2021, twenty pairs of KIRC tissues and matched normal tissues were collected from patients who underwent surgery at Shandong Provincial Hospital. All patients were fully informed of the study's purpose, and written consent was obtained. The ethical requirements of the Shandong Provincial Hospital Ethics Committee and the Helsinki Declaration were strictly followed. Total RNA was extracted from tissue lysates using the AG RNAex Pro Reagent (Accurate Biotechnology) and reverse transcribed using the Evo M-MLV RT Premix (Accurate Biotechnology). The SYBR^® Green Premix Pro Taq HS qPCR (Accurate Biotechnology) kit was used to perform qRT-PCR assay, and the LightCycle 480 II (Roche) was used to amplify the samples. The following primers were used: GAPDH-F: GGAGCGAGATCCCTCCAAAAT, GAPDH-R: GGCTGTTGTCATACTTCTCATGG, SLC34A1-F: GTTGTCCTACGGAGAGAGGC, SLC34A1-R: GGAAGGCATAGGCAGAGGTC.

RNA was extracted from cells using TRIzol reagent (15596026,Invitrogen™, USA) then, use Evo M-MLV RT Premix to reverse transcribe RNA to cDNA for RT-PCR (AG11706, Accurate Biotechnology, Hunan). The reaction conditions were 37°C 15 min, 85°C 5 s, and 4°C 10 min by real-time fluorescent quantitative PCR kits (AG11701, Accurate Biology, Hunan), and real-time fluorescence quantitative reaction system includes 1 μL cDNA, 1 μL primers, 5 μL SYBR Green, and 3 μL RNase/DNase-free water; general volume was 10 μL. The primers were sequenced as shown in Table 2. β-Actin is a housekeeping gene, and the data were computed by 2^−△△CT method.

Enzyme activities, including cinnamyl-alcohol dehydrogenase (CAD) (32 (link)), peroxidase (POD) (33 (link)), chalcone isomerase (CHI) (34 (link)), and flavonol synthase (FLS) (35 (link)), in the enriched pathways were determined with an ELISA Kit (Michy, Suzhou, China), and data were acquired using a microplate reader (SpectraMax^® 190, Molecular Devices, CA, USA). The data were then analyzed using ANOVA at a significance level of p < 0.05 on the SPSS19.0 platform.
The RNA of each sample was extracted with the Trelief^TM RNA Pure Plant Kit (TSP412, Tsingke, China), and a NanoDrop (OneC, Thermo, USA) was used to detect quality and concentration. Quality RNA was reverse-transcribed into cDNA with the Evo M-MLV RT Premix (Accurate-Biotechnology, AG11706, Hunan, China). Primers of DEGs enriched in CAD (Phvul.002G144800 and Phvul.003G029500), POD (Phvul.001G143300, Phvul.007G008400 and Phvul.008G249900), and FLS (Phvul.003G216600) were designed using Primer Premier 5.0, while Pvactin-11 was selected as the reference gene; the primer sequences are shown in Supplementary Table 2. The qRT-PCR program was conducted on a Light Cycler 480II (Roche Diagnostics, Switzerland), using a Hieff UNICON^® Universal qPCR SYBR Green Master Mix (Yeason, 11184ES03, Shanghai, China). Subsequently, the relative gene expression level was computed using the 2^−ΔCt method (36 (link)).