Gdna clean for qpcr

Total RNA was extracted from cultured cells using a commercially available kit (Qiagen, #74136) with the optional DNase digestion step. The RNA was reverse transcribed with an Evo M-MLV RT kit with gDNA Clean for qPCR (Accurate Biotechnology, China) and qRT-PCR was performed using a Roche LightCycler 480 with a SYBR Green Premix Pro Taq HS qPCR kit (Accurate Biotechnology) and the following cycling conditions: 95°C for 5 min followed by 45 cycles of 95°C for 10 s, 60°C for 10 s, and 72°C for 10 s. The relative level of each target gene was normalized to that of endogenous Rpl19 and calculated using the comparative Ct (ΔΔCt) method. The sequences of the utilized primers were as follows: 5′- TGGAAAATGGTTCGAGAGTCAG-3′ (forward) and 5′- CATTCCGTCTCTAGGTTAAAGCG-3′ (reverse) for Opa1; 5′-ACGGAGGCTGGGATGCCTTTG-3′ (forward) and 5′-AGTGATGCAGGCCCCGACCA-3′ (reverse) for Bcl2; and 5′-ACCTGGATGAGAAGGATGAG-3′ (forward) and 5′-ACCTTCAGGTACAGGCTGTG-3′ (reverse) for Rpl19.

Total RNA was extracted with the FastPure Cell/Tissue Total RNA Isolation Kit V2 from Vazyme (Nanjing, China) according to the manufacturer’s protocol. Reverse transcription was performed using an Evo M-MLV RT Mix Kit with the gDNA Clean for qPCR AG11728 or miRNA 1st strand cDNA synthesis kit AG11717 (Accurate Biotechnology, Hunan, China). qRT-PCR was performed using an ABI 7500 Fast Real-Time PCR system (Applied Biosystems, MA, USA) with an SYBR Premix Kit AG11701 (for mRNA) or AG11702 (for miRNA) (Accurate Biotechnology, Hunan, China). The levels of gene expression were quantified by the 2^−ΔΔCt method. GAPDH was used as the reference gene for mRNA, and U6 was used as the control for miRNA. The primer sequences used are listed in Table 1, and they were purchased from Sangon Biotech (Shanghai, China).

Total RNA was extracted from tissues and cells using the TRIzol Reagent (Invitrogen). 1 μg of total RNA was reverse transcribed using an Evo M-MLV RT Kit with gDNA Clean for qPCR (Accurate Biology). qRT-PCR was performed using a SYBR® Green Premix Pro Taq HS qPCR Kit and the StepOne Plus system (Applied Biosystems). GAPDH was used as the internal control gene. The relative expression levels of indicated genes were calculated using 2^−ΔΔCT method. The primer sequences were listed: UBA6-AS1-F: CCGGCTTCTTTACCACTTCTT, UBA6-AS1-R: GGCTGCATTCCTGAGAGATTAG; UBA6-F: TTGGTCCCAGTGTGTAGAATTAG, UBA6-R: AATCGTATGTCCAGAGGGAAAC.