Rneasy kit

Manufactured by Solarbio

Sourced in China

The RNeasy kit is a laboratory equipment designed for the extraction and purification of total RNA from various biological samples. It utilizes a silica-based membrane technology to efficiently capture and elute RNA molecules.

Automatically generated - may contain errors

Lab products found in correlation

Thermal cycler, by Thermo Fisher Scientific (1 mentions)

2 protocols using rneasy kit

Reverse Transcription PCR for Luciferase and β-actin

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA for PCR was extracted using an RNeasy kit (Solarbio, Beijing, China), which included a DNase digestion step to remove any contaminating DNA. Semiquantitative reverse transcription PCR was performed using a thermal cycler (Thermo), and amplified products were visualized using agarose gels. The following primers were used for PCR:

Luciferase forward: ACTGGGACGAAGACGAACAC.

Luciferase reverse: GGCGACGTAATCCACGATCT.

β-actin forward: GTGGGGCGCCCCAGGCACCA.

β-actin reverse: CTTCCTTAATGTCACGCACGATTTC.

Song M., Lv Q., Zhang X., Cao J., Sun S., Xiao P., Hou S., Ding H., Liu Z., Dong W., Wang J., Wang X., Sun Z., Tian M, & Fan H. (2016). Dynamic Tracking Human Mesenchymal Stem Cells Tropism following Smoke Inhalation Injury in NOD/SCID Mice. Stem Cells International, 2016, 1691856.

+ Open protocol

+ Expand

Quantifying Firefly Luciferase Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA for PCR was extracted with an RNeasy kit (Solarbio Science & Technology, Beijing, China), including a DNase digestion step to exclude contaminating DNA. Reverse transcription was performed using a Quant Script kit (TIANGEN BIOTECH, Beijing, China) for 1 h at 37°C. The primer sequences for the target gene were as follows: firefly luciferase-F: ACTGGGACGAAGACGAACAC and firefly luciferase-R: GGCGACGTAATCCACGATCT. PCR was carried out for the relative quantification of target gene copy numbers in relation to the β-actin transcript.

Cao J., Hou S., Ding H., Liu Z., Song M., Qin X., Wang X., Yu M., Sun Z., Liu J., Sun S., Xiao P., Lv Q, & Fan H. (2016). In Vivo Tracking of Systemically Administered Allogeneic Bone Marrow Mesenchymal Stem Cells in Normal Rats through Bioluminescence Imaging. Stem Cells International, 2016, 3970942.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!