The largest database of trusted experimental protocols

Atr inhibitor az20

Manufactured by Selleck Chemicals

AZ20 is an inhibitor of the ATR (ataxia telangiectasia and Rad3-related) protein kinase. ATR is a key regulator of the DNA damage response pathway. AZ20 functions by blocking the kinase activity of ATR, thereby affecting cellular processes related to DNA repair and cell cycle progression.

Automatically generated - may contain errors

3 protocols using atr inhibitor az20

1

Transcription and Replication Inhibition Assays

Check if the same lab product or an alternative is used in the 5 most similar protocols
Transcription inhibition was performed either by adding DRB (100 μM final concentration, Sigma-Aldrich), alpha-Amanitin (AMA, 20 μg/mL final concentration, Sigma-Aldrich) or Flavopiridol hydrochloride hydrate (FLV, 10 μM final concentration, Sigma-Aldrich) to the culture medium at 37°C 4 h before harvesting the cells. Inhibition of replicative synthesis was performed by adding Aphidicolin (Aphi, 1 μg/mL final concentration, Sigma-Aldrich) to the culture medium at 37°C 5 h before harvesting the cells. For ATR and ATM inhibition, cells were incubated with 2 μM ATR inhibitor AZ20 (Selleckchem) or 10 μM ATM inhibitor KU55933 (Tocris Bioscience) 1h before subsequent cell treatment. For FACT trapping, cells were incubated with 2 μM CBL0137 (Bertin Pharma) 15 min before subsequent cell treatment. The DSB-inducing agent neocarzinostatin (NCS, Sigma-Aldrich) was applied for 15 min at 50 ng/ml followed by 1 h recovery in fresh medium. For cell synchronization in late G2, cells were treated for 16 h with 2 mM Thymidine (Sigma-Aldrich), followed by 6 h release in fresh medium and 22 h treatment with the cdk1 inhibitor RO-3306 (10 μM final, Sigma-Aldrich).
+ Open protocol
+ Expand
2

Comprehensive Cell Culture Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols
T80 cells were grown in RPMI Medium supplemented with 10% FBS. HeLa, 293T, U2OS cells were grown in Dulbecco’s Modified Eagle’s Medium (DMEM) supplemented with 10% FBS. RPE1 cells were grown in DMEM F12 media supplemented with 10% FBS. RNF2 knockout T80 clones were generated using the CRISPR-Cas9 Double Nickase plasmid synthesized by Santa Cruz Biotechnology. U2OS cells stably expressing mCherry-LacI-Fok1 fusion protein that induces a DSB at a single genomic locus is previously described [58 (link)]. pyCAG_RNaseH1_WT and D210N plasmids were a gift from Dr. Xiang-Dong Fu (Addgene plasmids #111906, # 111904). Hydroxyurea (AC151680050), Aphidicolin (61197–0010) and DRB (NC9855607) were purchased from Fisher Scientific. alpha-amanitin was purchased from Santa Cruz Biotechnology (sc-202440). IdU (I7125) and CldU (C6891) were purchased from Sigma Aldrich. ATR inhibitor (AZ20) was purchased from SelleckChem.
+ Open protocol
+ Expand
3

Inducing Replication Fork Collapse

Check if the same lab product or an alternative is used in the 5 most similar protocols
Expression of shWRN was induced by adding 1 μg ml−1 doxycycline to cell culture medium for indicated time. The following siRNAs were used for experiments: siGenome Human siRNA Smartpool targeting WRN, MUS81, and SLX4, as well as non-targeting control pool (Horizon Discovery). WRN 5′ UTR (AAACCCGAGAAGAUCCAGUCCAACA) was described previously3 (link) and ordered from ThermoFisher. Cells were transfected using RNAiMax Transfection Reagent (ThermoFisher) according to manufacturer’s instructions. To induce exogenous replication fork collapse, cells were treated with aphidicolin (0.2 μg ml−1, Sigma Aldrich) for 24 h, and ATR inhibitor AZ20 (10μM, SelleckChem) was added for the final 8 h.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!