Lineage depletion kit

For analysis of progenitor populations, bone marrow (femur, tibia, and hip) and spleens were treated with ACK lysis buffer (Lonza) and washed in PBS containing 0.1% BSA (Fisher Scientific). Bone marrow and splenic progenitors were separated from lineage positive cells using the Lineage Depletion Kit (Miltenyi Biotech). Lineage negative populations were then stained with the Live/Dead indicator, Aquadead (Life Technologies/Thermo Fisher Scientific), in PBS at a dilution of 1:1000, washed in 0.1% BSA PBS, and stained with cell surface antibodies against lineage antigens (Mac1, Gr1, Ter119, B220, CD3, NK1.1) to detect residual lineage+ cells in combination with the following antibodies: anti-Sca1, anti-cKit, anti-CD41, anti-CD16/32, anti-CD150, anti-CD105, anti-CD71, and anti-CD24. Please refer to Supplemental Table I for a complete list of antibodies used in this study. Cells were analyzed using a MACS Quant (Miltenyi), Fortessa or LSRII (Becton Dickinson) and sorted with an Aria (Becton Dickinson).

For megakaryoblast culture, BM lineage negative cells from control (Jak2^+/+), heterozygous (Jak2^VF/+), hemizygous (Jak2^VF/−) and homozygous Jak2V617F (Jak2^VF/VF) mice were enriched using a lineage depletion kit (Miltenyi Biotec, Auburn, CA, USA) and were cultured in StemPro medium containing 20 ng/ml stem cell factor (SCF) and 50 ng/ml thrombopoietin (TPO) for 4–5 days as previously described.^{16 (link)} Primary erythroblasts were generated from the BM as previously described.^{10 (link)} For signaling studies, megakaryoblasts or erythroblasts were starved for 6 hr in IMDM medium containing 0.5% BSA at 37°C and cell lysates were prepared in radioimmunoprecipitation assay (RIPA) buffer (50mM Tris-HCl, 150mM NaCl, 1% Triton X-100, 1% Sodium deoxycholate, 0.1% SDS, 2mM Na₃VO₄, 5mM NaF, 100 µg/ml PMSF and protease inhibitor cocktail [Sigma-Aldrich, St. Louis, MO, USA]). Immunoblotting was performed using phospho-specific antibodies against Stat5, Akt, or Erk1/2 (Cell signaling Technology, MA), or antibodies against total Jak2, Stat5, Akt or Erk2 (Cell signaling Technology, MA or Santa Cruz Biotechnology, CA). β-actin was used as a loading control.

To explore the methylation modification of Thbs1 promoter, we obtained the nucleotide sequence of Thbs1 promoter region from Ensembl database with the ID number ENSMUSG00000040152. A 260bp region and a 147bp region of CpG island in Thbs1 promoter was predicted in website “http://www.urogene.org/cgi-bin/methprimer/methprimer.cgi”. The 260bp region located at chromosome 2: 117,942,070–117,942,330, with 19 CpG dinucleotides. The 147bp region located at chromosome 2: 117,942,405–117,942,552, with 12 CpG dinucleotides. We isolated the Lineage negative population by using Lineage Depletion Kit (Miltenyi Biotec). Genomic DNAs from Lineage negative cells were isolated by using Genomic DNA extraction Kit (ThermoFisher) and converted the unmethylated cytosines to uracils by using Epitect Bisulfite Kits (Qiagen). To amplify the CpG island region, we use Platinum II Taq Hot-Start DNA Polymerase (ThermoFisher) and follow the commercial protocol to conduct the PCR assay. For 260bp region, the forward primer is TTTTAGGTGGTTTTTAAAGAAGTAT, and the reverse primer is TAAAAAAACAAAAAACAAAAAAAA. For 147bp region, the forward primer is TTTAGTTAAGTTAGTTATTGTTTGGAGTTA, and the reverse primer is CTAATCATCTACAACCTAAAACTTTAAAAT. Then the amplified fragments were ligated to pCR 2.1-TOPO TA vector and conducted transformation. Three positive colonies were selected to extract plasmid and sequenced.