The largest database of trusted experimental protocols

10 protocols using n cad

1

Multiomics Evaluation of Anticancer Agents

Check if the same lab product or an alternative is used in the 5 most similar protocols
UNBS5162, amonafide, and 5FU were purchased from the American MedChemExpress, Monmouth Junction, NJ, USA. Further, reference antibodies Bcl-2 (proteintech, Rosemont, IL, USA; Cat# 12789–1-AP), active-Caspase3 (Abcam, Cam-bridge, UK; Cat# ab32042), Bax (proteintech, Cat# 50599–2-Ig), P70/S6K (Abcam, Cat# ab109393), AKT (Abcam, Cat# ab8805), p-AKT (Abcam, Cat# ab38449), mTOR (Abcam, Cat# ab32028), p-mTOR (Abcam, Cat# ab109268), Cyclin D1 (proteintech, Cat# 12363–1-AP), E-cad (Abcam, Cat# ab40772), Snail (proteintech, Cat# 13099–1-AP), N-cad (Abcam, Cat# ab6528), Twist (proteintech, Cat# 11752–1-AP), Slug (proteintech, Cat#) and GAPDH (proteintech, Cat# 60004–1-Ig) were used in this study. Our electrochemiluminescence kit was obtained from proteintech.
+ Open protocol
+ Expand
2

PI3Kβ Signaling Modulation Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols
Antibodies used were anti-p110β, -p110α and -pPKB (Ser 473) (Cell Signaling), pan-p85 (Millipore), -E-cad, PCNA (BD Biosciences), -PKB (Upstate Biotechnology), -β-actin, -α-tubulin (Sigma), -N-cad (Abcam) and --catenin (BD). For in vivo assays, we used Stealth PIK3CB siRNA that targeted the sequences AACCACTGGAATTTGATATTAATAT (siRNA1) or GATTCACAGATAGCATCTGAT (siRNA2), or control (scrambled-siRNA1) and vehicle (Invivofectamine), (Invitrogen). We prepared doxycycline (doxy)-inducible-pLKO-tet-PIK3CB shRNA vector by subcloning in the EcoRI site the oligonucleotide CCGGGATTCACAGATAGCATC TGATCTCGAGATCAGATGCTATCTGTGAATCTTTTT and its reverse complementary oligonucleotide. We used RNAiMAX (Invitrogen) and OptiMem (Life Technologies) for siRNA transfection. pLKO-Puro-CDH1 shRNA and the dexamethasone (Dex)-inducible pLK-pac vector encoding CDH1 have been described [52 (link)]. The PI3Kβ inhibitor AZD8186 was from Astra Zeneca [20 (link)] . PSG5-ER-myc-K805R-p110β was prepared as described [25 (link)]. To generate a siPIK3CB resistant-K805R-p110β, we used the oligonucleotide GGAATGA ACCACTCGAATTTCATATTAATATTTGTGACTT ACCAAGAATGG and its reverse complementary in a PCR reaction using Quickchange (Agilent). ER-myc-KR-p110β was cotransfected with siRNA using Lipofectamine 2000 (Invitrogen); these cells were treated with tamoxifen (1 µM, Sigma) 12 h before analysis.
+ Open protocol
+ Expand
3

Western Blot Analysis of EMT Markers

Check if the same lab product or an alternative is used in the 5 most similar protocols
After the determination of protein concentration of the cell lysates, each sample with equal amount of protein was subjected to SDS–PAGE (10% or 15%) and transferred to a PVDF membrane (Millipore, Burlington, MA). The membrane was incubated with the specific primary antibody overnight at 4°C, followed by incubation with HRP-conjugated anti-rabbit IgG (1:2000, Cell Signaling Technology, Boston, MA, cat# 7074S) or anti-mouse IgG (1:2000, Cell Signaling Technology, cat# 7076S). The signals were visualized with ECL solution (Millipore). The primary antibodies were as follows: E-cad (1:1000, Abcam, Cambridge, UK, cat# ab76055), N-cad (1:500, Abcam, cat# ab18203), α-SMA (1:500, Abcam, cat# ab5694), FN (1:500, Abcam, cat# ab2413), and ΔNp63α (1:500, Millipore, cat# ABS552). The antibody for GAPDH (1:10,000, ABclonal, MA, cat# AC035) was used as a control.
+ Open protocol
+ Expand
4

Comprehensive Antibody Characterization for EMT, Cell Cycle, and DNA Repair

Check if the same lab product or an alternative is used in the 5 most similar protocols
Antibodies for EMT, cell cycle, and DNA damage repair pathway were purchased as follows: ZEB-1 (CST:3396), N-CAD (CST:13116), E-CAD (CST:3195), Slug (CST:9585), Snail (CST:3879), Vimentin (CST:5741), β-catenin (CST:8480), CCND1 (CST:92G2), p21 (CST:2947 s), CDK4 (Abcam: Ab108357), CDK6 (Abcam:Ab124821), total ATM (CST:2873), phospho-ATM (Ser1981) (Abcam:5883), phospho-Chk2 (Thr68) (CST:2197), phospho-H2AX (Ser139) (CST:9718), RAD51 (Abcam:ab133534), and β-actin (CST:3700). All the western blot primary antibodies were 1:1000 diluted except RAD51 (1:10000 diluted). The antibody of HMGA2 (Proteintech, 20795-1-AP) was used in Immunohistochemistry (IHC).
+ Open protocol
+ Expand
5

Cellular Signaling Pathway Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Antibodies that recognize Cyclin D1 (Cell Signaling Technology, #2922), CDK4 (Cell Signaling Technology, #12790), β-actin (Sigma, A1978), NCAD (Abcam, ab98952), ECAD (Cell Signaling Technology, #3195), FOXO3 (Abcam, ab12162) and CTNNB1 (Ser33/37/Thr41) (Cell Signaling Technology, #4270) were used in the study. Horseradish peroxidase (HRP) labelled secondary antibody (Beyotime Biotech) was used in western blots. PS341 was purchased from Santa Cruz, sc-217785.
+ Open protocol
+ Expand
6

Western Blot Analysis of EMT Markers

Check if the same lab product or an alternative is used in the 5 most similar protocols
Equal amounts of whole-cell extracts were resolved by 10% SDS-PAGE and transferred to PVDF membranes. The membranes were blocked in 5% nonfat dry milk in TBST and incubated (2 h) with the indicated primary antibodies (CXCL5, E-cad, N-cad, Vimentin, CD44, P-AKT, T-AKT, P-NFκB and T- NFκB; 1:1000 dilution), followed by incubation (1 h) with goat anti-rabbit or anti-mouse secondary antibodies (1:5000 dilution; Sigma-Aldrich). Immunoreactivity was visualized by an enhanced chemiluminescence reagent (Perkin Elmer Cetus, Foster City, California, USA). To demonstrate equal loading, the blots were stripped and reprobed with a specific antibody against GAPDH (1:5000 dilution; Sigma-Aldrich). The antibodies against CXCL5, E-cad, N-cad, Vimentin, CD44, P-AKT, T-AKT, P-NFκB and T- NFκB were purchased from Abcam Biotechnology (Abcam, Cambridge, UK). All the measurements were performed in triplicate.
+ Open protocol
+ Expand
7

Characterization of YAP1 and NEK1 Signaling

Check if the same lab product or an alternative is used in the 5 most similar protocols
pFLAG-YAP1 was a gift from Yutaka Hata (addgene plasmid # 66853) and pEGFP-C3-hYAP1 was a gift from Marius Sudol (addgene plasmid # 17843), addgene (Watertown, MA, USA). The following antibodies were used in this study: mouse anti-YAP (dilution- 1:1000 in 5% Milk+TBST, Santa Cruz Biotechnology, SCBT, cat# sc101199, Dallas, TX, USA), rabbit anti-phospho-YAP-Y407 (custom generated by Life Technologies, Carlsbad, CA, USA), mouse anti-NEK1 (1:1000 in TBST, SCBT, cat# sc-398813, Dallas, TX, USA), rabbit anti-phospho-NEK1 pT141 (lab-generated by Life Technologies, Carlsbad, CA, USA), HRP-conjugated anti-β-tubulin (1:1000 in TBST, SCBT, cat# sc-23949, Dallas, TX, USA,), anti-FLAG (1:1500 in 5% Milk+TBST, Cell Signaling Technology, CST, cat# 14793S, D6W5B, Danvers, MA, USA), anti-GAPDH (1:1300 in 5% BSA+TBST, CST, cat# 2118S (14C10), anti-GFP (Thermo Fisher, cat# MA5-15256 (GF28R), Waltham, MA, USA), anti-phospho-ATR (T1989) (1:1000 in 5% Milk+TBST, CST, cat# 58014S), anti-BAX (1:1000 in TBST, SCBT, cat# sc-23959 (6A7),), E-Cad (1:1000 in TBST, CST, cat# 3195S,), N-Cad (CST, cat# 13116S), and rabbit anti-actin (1:1000 in TBST, Abcam, cat# ab1801, Cambridge, MA, USA). Secondary HRP-conjugated antibodies, anti-rabbit (CST, cat# 7074S) and anti-mouse (CST, cat# 7076S) were used to probe immunoblots.
+ Open protocol
+ Expand
8

Immunofluorescence Staining of Stem Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Cells were fixed in 4% paraformaldehyde in DPBS for 20 minutes and permeabilized with 1% Triton X-100 for 20 minutes at room temperature. After 60 minutes blocking with 2% normal goat serum, cells were incubated with primary antibody overnight at 4°C, washed, and stained with secondary antibodies (1:300, goat anti-rabbit IgG-Cy3; or 1:300, goat anti-mouse IgG-Cy3) for 60 minutes at room temperature and then washed three times with phosphate-buffered saline (PBS). The primary antibodies for respective cells include OCT4 (1:200, Abcam), NANOG (1:200, Abcam), PAX6 (1:200, Abcam), SOX2 (1:200, Abcam), NESTIN (1:200, Abcam), SOX1 (1: 200, Abcam), ZO-1 (1:100, Abcam), N-CAD (1: 100, Abcam), MAFB (1:300, Sigma), SOX9 (1:300, EMD Millipore), PRDM1 (1:200, Cell Signaling Technology), and NR2F1 (1:300, R&D Systems). DAPI (4', 6-diamidino-2-phenylindole) (1:500) was used as counter-staining for nuclei. The images were captured and analyzed with the Olympus IX73 and Image J.
+ Open protocol
+ Expand
9

Cell Signaling Pathway Antibodies

Check if the same lab product or an alternative is used in the 5 most similar protocols
Antibodies that recognize pAKT (Ser473) (Cell Signaling Technology, #9271), AKT (Cell Signaling Technology, #9272), pERK (Thr202/Tyr204) (Cell Signaling Technology, #4370), ERK (Cell Signaling Technology, #4695), p85α (Santa Cruz, sc-376112), p110α (Cell Signaling Technology, #4249), β-actin (Sigma, A1978), NCAD (Abcam, AB98952), ECAD (Cell Signaling Technology, #3195), VIM (RV202) (Abcam, AB8978), ZEB1 (D80D3) (Cell Signaling Technology, #3396), pGSK3β (Ser9) (Cell Signaling Technology, #9323), GSK3β (Y174) (Abcam, AB32391), and non-phospho CTNNB1 (Ser33/37/Thr41) (Cell Signaling Technology, #4270) were used in the study. Horseradish peroxidase (HRP) labelled secondary antibody (Beyotime Biotech) was used in western blots. Protein A-Sepharose 4B beads (Invitrogen, 10-1041) was used for immunoprecipitation studies.
+ Open protocol
+ Expand
10

Western Blot Analysis of Cellular Proteins

Check if the same lab product or an alternative is used in the 5 most similar protocols
Cells were harvested and proteins were extracted from cells as previously described 46 (link). The protein concentration was determined using a protein assay kit (Bio-Rad, Hercules, CA, USA). Equal amounts of proteins (30 µg) were resolved by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and then transferred onto a polyvinylidene fluoride (PVDF) membrane (Millipore, Bedford, MA, USA). After blocking with 5% non-fat milk, the membrane was incubated overnight at 4 ºC with the primary antibody. The primary antibodies used in our study were as follows: α-SMA, 1:1000; FAP, 1:1000; FSP1, 1;300; vimentin, 1:1000; E-cad, abcam, #ab216833, 1:500; N-cad, abcam, #ab216833, 1:500; FN1, proteintech, 15613-I-AP, 1:500; Slug, Santa Cruz, sc-166476, 1:200; Snail, Santa Cruz, sc-393172, 1:200, and ZEB1, CST, #70512, 1:1000. Then HRP-conjugated secondary antibodies (1:3000) purchased from ZhongShanJinQiao (BeiJing, China) were incubated and the signal was detected with enhanced chemiluminescence.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!