Pmy ires gfp retroviral vector

The murine Icos gene was derived from mouse cDNA (Thermo, Cat. MMM1013-7510186) and produced by PCR using the primers: (Forward primer: gcGAATTCgccacc ATG AAG CCG TAC TTC TGC CGT GTC TTT G, Reverse primer: cgCTCGAG TTA TGA GGT CAC ACC TGC AAG). The resulting PCR fragment was cloned into the pMY-IRES-GFP retroviral vector (Cell Biolabs, RV-021) using EcoRI and XhoI cut sites. The Platinum-E retroviral packaging cell line (Cell Biolabs, RV-101) was used to produce the ICOS-containing retrovirus. The cells were maintained in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% heat-inactivated fetal calf serum (FCS), 1ug/ml puromycin, 10ug/ml blasticidine, 100 U/mL penicillin, and 100 μg/mL streptomycin at 37°C in a 5% CO₂, humidified atmosphere. The packaging cells were incubated in 10 cm plates at 4.5 × 10⁶/plate overnight at 37 °C. Transfections were performed using Lipofectamine LTX (Invitrogen, 15338-100). Cells were transiently transfected with 10 μg DNA (ICOS plasmid DNA or empty vector control). After 48 hours incubation the culture supernatant was harvested and virus was concentrated per manufacturer’s instructions (Cell Biolabs, RV-201).

The murine 2B4 gene was derived from mouse cDNA (OriGene: MC209044-113649) and produced by PCR using the primers: (Forward: GCGAATTCGCACCATGTTGGGG CAAGCTGTCCTGTTCACAA, Reverse: CGCTCGAGCTAGGAGTAGACATCAAAGTT CTC). The resulting PCR fragment was cloned into the pMY-IRES-GFP retroviral vector (Cell Biolabs, RV-021) using EcoRI and XhoI cut sites. The Platinum-E retroviral packaging cell line (Cell Biolabs, RV-101. Ecotropic for rat and mouse cells) was used to produce the 2B4-containing retrovirus. The cells were maintained in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% heat-inactivated fetal calf serum (FCS), 1 μg/ml puromycin, 10 μg/ml blasticidine, 100 U/mL penicillin, and 100 μg/mL streptomycin at 37°C in a 5% CO₂, humidified atmosphere. The packaging cells were incubated in 10-cm plates at 4.5×10⁶/plate overnight at 37°C. Transfections were performed with the reagent Lipofectamine LTX (Invitrogen, 15338-100). Cells were transiently transfected with 10 μg DNA (2B4 plasmid DNA or empty-vector control). After 48 hours incubation the culture supernatant was harvested and virus was concentrated per manufacturer’s instructions (Cell Biolabs, RV-201).