Qpcr core kit for sybr green 1

Colonic tissue (1 cm) was added to 1.0 ml Extrazol (Biolab Innovative Research Technologies) and stored at −80°C or used directly for homogenization with the Ultra-Turrax (IKA) homogenizer. The total RNA isolation was performed according to manufacturer’s instructions. Afterward, the RNA was treated with the TURBO DNA-free™ Kit (invitrogen, Thermo Fisher Scientific) following the manufacturer’s routine DNase treatment protocol. The RNA concentration was measured using NanoDrop system (Thermo Fisher Scientific). cDNA was synthesized from 500 ng RNA using the RevertAid First Strand cDNA Synthesis Kit (Thermo Fisher Scientific) following the manufacturer’s instructions. Reaction mix without RevertAid M-MuLV RT was used as a control for genomic DNA contamination. RT-PCRs were run using the qPCR Core kit for SYBR® Green I (Eurogentec) according to manufacturer’s instructions. Samples were run in duplicates. The specificity of the amplicon was confirmed by melting curve analysis. To control for contamination, the amplification of controls for genomic DNA were evaluated and non-template control (PCR-grade water) was included in every run. Via ΔΔCt method the relative quantity of target DNA was quantified using glycerinaldehyd-3-phosphat-dehydrogenase (GapDH) as housekeeping gene.

Real-time PCR was used for quantification of pathogen colonization in planta using an ABI7300 PCR machine (Applied Biosystems) in combination with the qPCR Core kit for SYBR Green I (Eurogentec, Maastricht, The Netherlands) and analyzed using the 7300 System SDS software (Applied Biosystems). Unless described otherwise, the primer pair AtRub-F4 and AtRub-R4 targeting the gene encoding the large subunit of RuBisCo was used as endogenous control. Verticillium and R. solanacearum colonization was assessed as previously described [13] (link), [23] (link).

Acenaphthenol, benzyloxyresorufin, bicinchoninic acid (BCA) assay kit, cytochrome c, NADH, NADPH, NADP⁺, 7-ethoxyresorufine, menadione, 7-methoxyresorufine, β-naphthoflavone, p-nitrophenyl sulfate, resorufin, R-sulforaphane, 3′-phosphoadenosin-5′-phosphate, and UDP-glucuronic acid were purchased from Sigma-Aldrich (Prague, Czech Republic). Midazolam was obtained from Toronto Research Chemicals (North York, ON, Canada). All other chemicals used were of HPLC or analytical grade. For real-time Polymerase Chain Reaction (PCR) analyses, ProtoScript^® II Reverse Transcriptase was purchased from NEB (Ipswich, UK), TriReagent from Biotech (Prague, Czech Republic), and the qPCRCore kit for SYBR Green I from Eurogentec (Seraing, Belgium).

Total RNA was extracted from exosomal fractions (n = 5) and whole cortex (n = 8) using the RNeasy kit from Qiagen (Qiagen, Hilden, Germany). For the analysis of exosomal RNA, mRNA-specific amplification was performed using the Arcturus RiboAmp HS PLUS Kit (Life Technologies, Paisley, UK) prior to real-time quantitative reverse transcriptase PCRs (RT-qPCR). cDNA synthesis and RT-qPCRs were performed as described earlier using the qPCR Core Kit for Sybr Green I (Eurogentec, Seraing, Belgium) and a 7300 real-time PCR machine (Applied Biosystems, Weiterstadt, Germany) [14] (link). Sequences of primers used for PCR are listed in Table 1. Each sample was normalized to the expression of the reference gene cyclophilin A. Cyclophilin A was chosen because of its high expression of urinary exosomes without significant changes during the course of PAN as demonstrated in the gene array analysis.

Six separate hypothalamic samples were used for RNA isolation. Quantitative PCR was performed using a qPCR Core kit for SYBR Green I (Eurogentec, The Netherlands). Gene specific primers were designed to span introns. The sequences forward and reverse were as follows: β-actin, 5′-CCCTGGCTCCTAGCACCAT and 5′-GAGCCACCAATCCACACAGA, Hprt, 5′-TGGTCAAGCAGTACAGCCCCA and 5′- GGCCTGTATCCAACACTTCGAGAGG; Mc3r, 5′-GCAACCGGAGTGGCAGTGGG and 5′-GGGGAGTGCAGGTTGCCGTT; Mc4r, 5′-CTCCCGGGCACGGGTACCAT and 5′-AACGGGGCCCAGCAGACAAC; Agrp, 5′-AGACAGCAGCAGACCGAGCAGA and 5′-CACAGCGACGCGGAGAACGA; Pomc, 5′-AGACGTGTGGAGCTGGTGCC and 5′-CTGCAGGCCCGGATGCAAGC; Ucp2, 5′-ATGAGCTTTGCCTCCGTCCGC and 5′-GGGCACCTGTGGTGCTACCTG; Bmp8b, 5′-CCACGCCACTATGCAGGCCC and 5′-GGCACTCAGCTTGGTGGGCA. Gene expression was calculated using the ΔC_t method relative to the mean of 2 housekeeping genes (Actb and Hprt), and mean values +/- SEM are shown in Table S1.