Sybr green pcr master mix kit

Total RNA in the myocardial tissues of each group was extracted by using an RNA extraction kit (Invitrogen, Carlsbad, California, USA). The miR-93, LIMK1, RhoA, ROCK1, U6 and glyceraldehyde phosphate dehydrogenase (GAPDH) primers were designed by Invitrogen (Carlsbad, CA, USA) (Table 1), the the internal reference of miR-93 was U6, and the internal reference of LIMK1, RhoA and ROCK1 was GAPDH. The RNA was then reversed to obtain cDNA according to the PrimeScript RT kit instructions. RT-qPCR was performed by SYBR Green PCR Master Mix kit (Roche, Arizona, USA). The relative transcription levels of the target genes were calculated by 2^-ΔΔCt method. The experiment was repeated three times and the final data was averaged.

The total RNA was isolated from cells and tissue extracts while using TRIzol reagent (Invitrogen). Reverse transcription was performed using a Maxima First Strand cDNA Synthesis Kit (Thermo Scientific). Quantitative real-time RT-PCR was performed while using a SYBR Green PCR Master Mix Kit (Roche Diagnostics, Indianapolis, IN, USA)) and a CFX Connect Real-Time PCR system (Bio-Rad). The PCR conditions were, as follows: 45 cycles of 95 °C for 30 s, 60 °C for 10 s, and 72 °C for 15 s. The primer sequences are in Supplementary Table S1. GAPDH was used as an internal standard.

Total RNA was isolated from cells and tissue extracts, using the Trizol reagent (Invitrogen, MA, USA). Reverse transcription was performed using the Maxima First Strand cDNA synthesis kit (Thermo scientific, MA, USA). Quantitative real-time RT-PCR was performed using a SYBR Green PCR master mix kit (Roche Diagnostics, Indianapolis, Indiana) and a Light Cycler 96 instrument (Roche Diagnostics). PCR parameters were as follows: 45 cycles of 95°C for 30 s, 60°C for 10 s, and 72°C for 15 s. Primer sequences were as follows: human Collagen forward, 5′-CACACGTCTCGGTCATGGTA-3′, and reverse, 5′-AAGAGGAAGGCCAAGTCGAG-3′; mouse collagen forward, 5′- GCCTTGGAGGAAACTTTGCTT- 3′ and reverse, 5′- GCACGGAAACTCCAGCTGAT -3′; human CTGF forward, 5′-CACCCGGGTTACCAATGACA-3′, and reverse, 5′-TCCGGGACAGTTGTAATGGC-3′; mouse CTGF forward, 5′-CCAGACCCAACTATGATGCG-3′, and reverse, 5′-GTGTCCGGATGCACTTTTTG-3′; mouse TGF-β forward, 5′-AAATCAACGGGATCAGCCCC-3′, and reverse, 5′-GGATCCACTTCCAACCCAGG-3′; mouse αSMA forward, 5′ – CAGGCTGTGCTGTCCCTCTA - 3′, and reverse, 5′- CGGCAGTAGTCACGAAGGAA - 3′; human GAPDH forward, 5′-GGAGCCAAAAGGGTCATCAT-3′, and reverse, 5′-GTGATGGCATGGACTGTGGT-3′; mouse GAPDH forward, 5′- ACGACCCCTTCATTGACCTC -3′, and reverse, 5′- ATGATGACCCTTTTGGCTCC-3′. GAPDH was used as an internal standard.