Cellular RNA from freshly excised PVAT (thoracic and abdominal), WAT (renal and gonadal) and BAT (inter-scapular) was stabilized and protected using RNAlater® solution (ThermoFisher Scientific, AM7020). Tissues were homogenized individually. RNA was isolated using chloroform and isopropanol. A high capacity RNA-cDNA kit (Applied Biosystems, 4387406) was used to convert the RNA into cDNA. Samples were heated on a thermocycler (Applied Biosystems) at 37°C for 60mins before heating to 95°C to stop the reaction. The 96 well Fast SYBR Green (Life Technologies, 4472908) Δ-ΔCᴛ qPCR method (ViiA7 qPCR machine; Applied Biosystems) was used to quantify gene expression. The following primers were used: Asc-1 (FP: ACAGGCCAGGATCTAAGGTG, RP: CCTCGTGGGGTCTCAACATA), PAT2 (FP: CCTTCCTGAGAGTGCCAAGA, RP: TGTCTGGAACCCGGTTATGC), galectin-3 (FP: ACCCAACGCAAACAGGATTG, RP: TGTCCTGCTTCGTGTTACAC), iNOS (FP: TATTTTCAGGGCTTGCGTGG, RP: CCACCTCTCCTGGCTTGATG), CD11c (FP: ACGCTTACCTGGGTTACTCC, RP: AAGATGACAACCTTCCCCGT), Arg1 (FP: ACAAGACAGGGCTCCTTTCA, RP: TGCCGTGTTCACAGTACTCT) and CD206 (FP: GTTCAGCTATTGGACGCGAG, RP: AGTTGCCGTCTGAACTGAGA). The normalization control was β-actin (FP: TGGCACCACACCTTCTACAA, RP: AGGTCTCAAACATGATCTGGGT). Results were presented as the average change in expression (CIA vs. naïve) in DBA/1 wild-type mice.
Viia7 qpcr machine
Manufactured by Thermo Fisher Scientific
Sourced in United States
The ViiA7 qPCR machine is a real-time PCR system designed for quantitative gene expression analysis. It features a 96-well plate format and supports a wide range of fluorescent dyes and probes for precise, sensitive, and reproducible results.
Automatically generated - may contain errors
Lab products found in correlation
Fast sybr green master mix, by Thermo Fisher Scientific (8 mentions)
Rneasy mini kit, by Qiagen (5 mentions)
Iscript cdna synthesis kit, by Bio-Rad (4 mentions)
Nih 3t3 mouse fibroblast, by American Type Culture Collection (3 mentions)
Maxima h minus first strand cdna synthesis kit, by Thermo Fisher Scientific (3 mentions)
Taqman probe, by Thermo Fisher Scientific (2 mentions)
Sybr green pcr mix, by Thermo Fisher Scientific (2 mentions)
Luna qpcr master mix, by New England Biolabs (2 mentions)
Multiscribe reverse transcriptase, by Thermo Fisher Scientific (2 mentions)
Custom made dna primers, by Integrated DNA Technologies (2 mentions)
Custom dna primers, by Integrated DNA Technologies (2 mentions)
Thermocycler, by Thermo Fisher Scientific (1 mentions)
High capacity rna cdna kit, by Thermo Fisher Scientific (1 mentions)
Sybr green, by Thermo Fisher Scientific (1 mentions)
Rnalater solution, by Thermo Fisher Scientific (1 mentions)
Cdna synthesis reagents, by Promega (1 mentions)
Rneasy column, by Qiagen (1 mentions)
Faststart universal sybr green master mix rox, by Roche (1 mentions)
Maxwell 16 lev simplyrna tissue kit, by Promega (1 mentions)
Reverse transcription system kit, by Promega (1 mentions)
26 protocols using viia7 qpcr machine
1
Gene Expression Analysis of Adipose Tissue Depots
2
Quantitative Gene Expression Analysis of Immune-Related Factors
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was isolated from cells using RNeasy columns (Qiagen). 1 μg of RNA was reversed transcribed using cDNA synthesis reagents (Promega). qPCR was performed using the following 6-carboxyfluorescein-labeled TaqMan probes (Thermo): APOBEC3A (Hs00377444_m1), APOBEC3B (Hs00358981_m1), ACTB (Hs01060665_g1), 18S (Hs03003631_g1) IL1A (Hs00174092_m1), IL1B (Hs01555410_m1), dN-TP63 (Hs00978339_m1), total TP63 (Hs00978340_m1), RELA (Hs01042014_m1), RELB (Hs00232399), C-REL (Hs00968440_m1), IRF3 (Hs01547283_m1), STAT1 (Hs01013996_m1). qPCR was performed using an AB Applied Biosystems ViiA7 qPCR machine.
3
Quantitative PCR of Genomic Targets
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
qPCR reactions were performed using FastStart Universal SYBR Green Master Mix (Rox) (Roche 04913914001), 0.03–10 ng of template DNA, and 2.5 μM of each qPCR primer (Table 1 ). The reactions were performed in 384-well plates on a ViiA 7 qPCR machine (Applied Biosystems). The reaction parameters were the same as previously reported [45 (link)], and the CT values were normalized to an intergenic region (IGR) [44 (link)]. Biological replicates were performed in technical triplicate.
4
Quantitative RNA Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from slices using a Maxwell 16 LEV SimplyRNA Tissue Kit (Promega, Leiden, The Netherlands). After confirming the yield and purity with a ND-100 spectrophotometer (NanoDrop Technologies, Wilmington, USA), isolated RNA was reverse transcribed using a Reverse Transcription System Kit (Promega) and thermal cycler (22°C for 10 min, 42°C for 15 min, and 95°C for 5 min). Real-time quantitative polymerase chain reaction (qPCR) was performed using specific primers (Table 1 ), FastStart Universal SYBR Green Master Mix (Roche, Almere, The Netherlands), and a ViiA7 qPCR machine (Applied Biosystems, Bleiswijk, The Netherlands), which was configured with 1 cycle of 10 min at 95°C and 40 consecutive cycles of 15 s at 95°C, 30 s at 60°C, and 30 s at 72°C. mRNA expression was calculated as fold induction, using Ywhaz as a reference gene.
5
Quantifying Epstein-Barr Virus in B-cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To quantify the number of EBV genome copies per donor B-cells, memory B-cells (CD19+/CD27+) were sorted using FACS Aria II (BD Biosciences, San Diego, CA, USA) from donor PBMCs. Total nucleic acid was extracted from sorted memory B-cells using QIAamp DNA Mini Kit (Qiagen, Germantown, MD, USA). Quantitative PCR (qPCR) was carried out with Fast SYBR green master mix (Applied Biosystems, Bedford, MA, USA) and run on a Viia7 qPCR machine (Applied Biosystems, Bedford, MA, USA). EBV DNA was quantified with primers specific to the EBV EBNA1 locus (forward: TCATCATCATCCGGGTCTCC, reverse: CCTACAGGGTGGAAAAATGGC), and signals were normalized to host genome DNA using primers specific for human beta-actin (ACTB) gene (forward: CAGGCAGCTCG-TAGCTCTTC, reverse: TTGTGGCTCAGGGAAAATGT). The relative gene expression was calculated as the 2-Δct method with Δct = ct(EBNA1) − ct(host genome control). We also quantified the EBV genome copies on mouse serum at multiple time points after PBMC inoculation.
6
Quantitative PCR of Tendon Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Protocols for RNA extraction from healthy and diseased tendon tissues and cells, complementary DNA synthesis and quantitative polymerase chain reaction are described elsewhere [8 (link)]. cDNA, 2 μL, was used in a 10-μL qPCR volume with Fast SYBR Green Master Mix (Applied Biosystems) and diluted Qiagen validated human primers including PDPN (QT01015084), CD248 (QT00216356), CD106 (QT00018347) β-actin (QT00095431) and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (QT00079247). Duplicate reactions for each gene were run on a ViiA7 qPCR machine (Applied Biosystems) and results were calculated using the DDCt method using reference genes for human β-actin and GAPDH. Results were consistent using these reference genes and data are shown normalized to β-actin.
7
Quantitative RT-PCR for AID Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Quantitative RT-PCR was as described previously TaqMan qRT-PCR assays (Applied Biosystems) consisting of amplification primers and fluorescently labelled MGB-probes were used to quantify AID expression49 (link). qRTPCR was performed in triplicate for each sample with each gene multiplexed with an18s endogenous control (taqman assay labelled with different dye). Samples were run on a viia7 qPCR machine (Applied Biosystems) and subjected to ∆CT analysis relative to 18S expression.
8
Tendon Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA isolation and real-time quantitative polymerase chain reaction (RT-qPCR) on tendon samples was performed according to previously described protocol [18 (link)]. Gene signatures consisted of a panel of genes using Qiagen validated human primers including PTGIS (PGIS, QT00047747), PTGIR (IP receptor, Q00072807), PTGS2 (COX-2, QT00040586), PTGS1 (COX-1, QT00210280), PTGES (mPGES-1, QT00208607), ACTB (β-actin, QT00095431), and GAPDH (GAPDH, QT00079247). The reaction efficiency was calculated by measuring the Ct values for both sets of genes in a cDNA mix dilution series and applying the following formula: Efficiency = 10(− 1/slope) − 1 as previously described [25 ]. Duplicate reactions for each gene were run on a ViiA7 qPCR machine (Applied Biosystems), and results were calculated using the DDCt method using reference genes for human ACTB (β-actin) and GAPDH (GAPDH). Results were consistent using these reference genes, and data are shown normalized to β-actin.
9
Quantitative PCR Protocol for Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Protocols for RNA extraction, complementary DNA synthesis and quantitative PCR are described elsewhere.8 (link) Validated human primers are listed in online supplementary table 2 . Reactions were run in duplicate for each gene on a ViiA7 qPCR machine (Applied Biosystems). Results were calculated using the DDCt method using reference genes for human β-actin and glyceraldehyde 3-phosphate dehydrogenase. Results were consistent using these reference genes, and data shown are normalised to β-actin.
10
Quantifying 20-Hydroxyecdysone in Drosophila
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
20E measurement was performed with the 20-hydroxyecdysone EIA kit (Cayman, item No. 501390). 5–10 fly bodies or 10–15 brains were dissected and homogenized in 70% methanol. The homogenates were then dried by the evaporator, redissolved in the kit’s buffer, and measured based on the manufacturer’s protocol. Adult fly brains (usually 10) or fly bodies (usually 5) were subjected to RNeasy Plus Mini Kit for RNA extraction, followed by cDNA reverse transcription using random hexamers and Superscript II (Invitrogen) to generate cDNA. The cDNA was then amplified using SYBR Green PCR mix (Cat# 4364346) and oligonucleotides listed in the Key resource table with the Applied Biosystems ViiA7 qPCR machine. Relative transcript levels were calculated by ddCT.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!