As described previously [19 (link)], total RNA was extracted from tissue samples and PC cells with TRIZOL reagent under the manufacturer (Takara Bio, Otsu, Japan). We keep equal quantity for RNA level in all samples via nucleotide determination before qRT-PCR detection. cDNA was synthesized from total RNA using the Expand Reverse Transcriptase Kit (Thermo Biotech Inc, USA). The expression of MSI2 and Numb was analyzed in a Light Cycler 2.0 with the Light Cycler kit (Takara). The conditions were as follows: 95°C for 30s, 40 cycles of 95°C for 5s and 60°C for 30s. DEPC water was used in place of the template cDNA for the negative control. The primers were as follows: MSI2, 5’ - AGACCTCACCAGATAGCCTTAG -3’ (sense) and 5’ - CCACTACTGTGTTCGCAGATAA -3’ (antisense); Numb, 5’ - CACTCGTCGCTGGATCTGTCA - 3’ (sense) and 5’ - CACAGCCTACTGCATGGCTCA -3’ (antisense); GADPH, 5’ - CATGAGAAGTATGACAACAGCCT -3’ (sense) and 5’ - AGTCCTTCCACGATACCAAAGT -3’ (antisense). The quality of the PCR products was determined by post-PCR melt-curve analysis. The expression level was calculated using the 2-△△Ct method (relative quantification). Each experiment was repeated three times.
Light cycler kit
Manufactured by Takara Bio
Sourced in Japan
The Light Cycler kit is a laboratory equipment designed for real-time PCR analysis. It provides a platform for the amplification and quantification of DNA or RNA samples. The kit includes a thermal cycler, optical detection system, and associated reagents and software to enable efficient and accurate real-time PCR experiments.
Automatically generated - may contain errors
Lab products found in correlation
Light cycler 2, by Takara Bio (4 mentions)
Trizol reagent, by Takara Bio (3 mentions)
Deoxyribonuclease, by Takara Bio (1 mentions)
Trizol total rna extraction reagent, by Thermo Fisher Scientific (1 mentions)
Hairpin it microrna, by GenePharma (1 mentions)
U6 snrna normalization rt pcr quantitation kit, by GenePharma (1 mentions)
Mmlv reverse transcriptase, by GenePharma (1 mentions)
7 protocols using light cycler kit
1
Quantitative Expression Analysis of MSI2 and Numb
2
Quantitative Analysis of DUSP5 Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from cells by Trizol, respectively. RNA was treated with deoxyribonuclease to dislodge contaminating genomic DNA (Takara Bio Inc., Japan) before reverse transcription. The complementary DNA was synthesized in a 20 μl volume using the Light Cycler kit (Takara Bio Inc., Japan) according to the manufacturer's instructions. β‐actin was as an internal control for DUSP5. The relative expression level between treatments was calculated by 2−(ΔCtsample − ΔCtcontrol). The primers sequences: DUSP5 F:ATCCTGAGTGTTGCGTGGATGTA R:CTCGCACTTGGATGCATGGTA
β‐actin F:TGGCACCCAGCACAATGAA R:CTAAGTCATAGTCCGCCTAGAAGCA
β‐actin F:TGGCACCCAGCACAATGAA R:CTAAGTCATAGTCCGCCTAGAAGCA
3
Quantitative analysis of Numb gene expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
As described previously [19 (link), 20 (link)], mRNA from PC tissues and cell lines was analyzed in a Light Cycler 2.0 with the Light Cycler kit (Takara Bio, Japan). The primers were as follows: Numb-PRRL, 5’-CTTCCAAGCTAATGGCACTG-3’ (sense) and 5’-CTCTTAGACACCTCTTCTAACCA-3’ (antisense); Numb-PRRS, 5’-CAATCTCCTACCTTCCAAGGG-3’ (sense) and 5’-CGGACGCTCTTAGACACCTC-3’ (antisense). The quality of the PCR products was monitored with post-PCR melt-curve analysis. The expression level of these target genes was calculated by the −ΔΔCt method.
4
Quantifying Gene Expression in HVSMCs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from HVSMCs using TRIzol total RNA extraction reagent (Invitrogen, United States). cDNA was synthesized using a Light Cycler kit (Takara, Japan). GAPDH was used as an endogenous control for each sample. The relative expression level of the target genes was analyzed by the 2 − (ΔCt sample – ΔCt control) method. The primer sequences were as follows: GRIA2 F: AAAGAATACCCTGGAGCACAC and R: CCAAACAATCTCCTGCATTTCC; ENPP3 F: CGACTGCACTATGCCAAGAA and R: CATGGGCATCCTCATAGCTT; and GAPDH F: AGGTCGGTGTGAACGGATTTG and R: GGGGTCGTTGATGGCAACA.
5
Colorectal Cancer miR-944 Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All RNA was extracted from the CRC cell lines and colorectal tissue stored at −80°C by TRIzol reagent (Takara Bio, Otsu, Japan) following the manufacturer's instructions. Reverse transcription reactions and real‐time PCR reactions were performed by a Hairpin‐it microRNA and U6 snRNA Normalization RT‐PCR Quantitation Kit (GenePharma, Shanghai, China). The expression of miR‐944 was measured by a Light Cycler kit (Takara Bio) system according to the manufacturer's thermocycling conditions as follows: 95°C for 3 minutes, followed by 45 cycles at 95°C for 12 seconds and 62°C for 45 seconds. Here, U6 snRNA was used as an internal control. Fold changes (2−ΔΔCt) were used to analyse the relative expression of miR‐944. Each experiment was replicated three times.
6
Quantification of miR-543 Expression in Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
According to the manufacturer’s protocol, total RNA was extracted from homogenized cell samples with TRIzol reagent (Takara Bio, Otsu, Japan). For each sample, 6 μg of RNA from cell lines was used for reverse transcription with MMLV reverse transcriptase (Genepharma, Suzhou, China). The primer sequences were as follows: miR-543 forward: 5′- CAGTGCTAAAACATTCGCGG -3′ and reverse: 5′- TATGGTTGTTCACGACTCCTTCAC -3′; and U6 snRNA forward: 5′- CGCTTCGGCAGCACATATAC-3′, and reverse: 5′- TTCACGAATTTGCGTGTCATC-3′. Each PCR was conducted at 95˚C for 3 min, followed by 45 cycles at 95°C for 12 s and 62°C for 50 s. The expression of miR-543 was determined using Light Cycler 2.0 with the Light Cycler kit (Takara, Japan), and the U6 gene was used as the internal control for miR-543.
7
Quantitative Real-Time PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
As described previously (Fan et al., 2019 (link)), qRT-PCR was analyzed in a Light Cycler 2.0 with the Light Cycler kit (Takara Bio, Otsu, Japan) for the following conditions: 95°C for 30 s, 40 cycles of 95°C for 5 s, and 60°C for 30 s. The primers: FAM172A, 5′-CGACTGGCGAACTGGAAG -3′ and 5′-GAGCTCAAGGAAATAGACATCAATC -3′; E-cad, 5′-CAGCGTGTGTGACTGTGAAG -3′ and 5′-AAACAGCAAGAGCAGCAGAA -3′. GADPH, 5′-CATGAGAAGTATGACAACAGCCT -3′ and 5′-AGTCCTTCCACGATACCAAAGT -3′. Quality of the PCR products was monitored with post-PCR melt-curve analysis using the ΔΔCt calculation.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!