Cell-surface sialic acids were labeled using aniline-catalyzed oxime ligation (41 (link)). In comparison to labeling with Sambucus nigra lectin (SNA) (Vector Laboratories), which are large and have defined preferences for specific Sia linkages, chemical labeling provides a more reproducible and quantitative measurement of cell-surface sialic acids (Fig. S5 ). To perform this reaction, we first prepared solution A (1 mM NaIO4 [Sigma-Aldrich] dissolved in PBS supplemented with 1 mM CaCl2) and solution B (1 mM CaCl2, 10 mM aniline [Sigma-Aldrich], 5% FBS and 100 μM CF633 hydrazide [Sigma-Aldrich], or CF488A hydrazide [Sigma-Aldrich] in cold PBS, pH 6.5 [Teknova]). The cells were cooled on ice and washed with cold PBS once before incubating with solution A on ice for 15 min, followed by a wash with cold PBS (pH 6.5) and incubation with solution B on ice for 40 min. The cells with labeled sialic acids were washed once with cold Opti-MEM, and their plasma membranes were labeled with CellMask Orange (Invitrogen) at a concentration of 2.5 μg/mL in Opti-MEM for 5 min at room temperature. The cells were washed again with Opti-MEM before imaging.
Sambucus nigra lectin sna
Manufactured by Vector Laboratories
Sourced in United States, Sweden
Sambucus nigra lectin (SNA) is a carbohydrate-binding protein derived from the elderberry plant (Sambucus nigra). It specifically recognizes and binds to sialic acid residues on glycoproteins. SNA is commonly used as a tool in glycobiology research and analysis.
Automatically generated - may contain errors
Lab products found in correlation
Maackia amurensis lectin 1 mal 1, by Vector Laboratories (3 mentions)
Dynamo colorflash sybr green qpcr kit, by Thermo Fisher Scientific (2 mentions)
Rneasy mini kit, by Qiagen (2 mentions)
Reverse transcriptase kit, by Promega (2 mentions)
Erythrina cristagalli lectin eca, by Vector Laboratories (2 mentions)
Maackia amurensis lectin 2 mal 2, by Vector Laboratories (2 mentions)
Alexa fluor 488, by Thermo Fisher Scientific (2 mentions)
Amicon ultra 0.5 ml centrifugal filter, by Merck Group (2 mentions)
Naio4, by Merck Group (1 mentions)
Cellmask orange, by Thermo Fisher Scientific (1 mentions)
Cf488a hydrazide, by Merck Group (1 mentions)
Aniline, by Merck Group (1 mentions)
Integrin antibody sampler kit, by Cell Signaling Technology (1 mentions)
Sialidase, by Roche (1 mentions)
Maackia amurensis lectin, by Vector Laboratories (1 mentions)
Siglec e sirna, by Santa Cruz Biotechnology (1 mentions)
Giemsa stain, by Merck Group (1 mentions)
Aleuria aurantia lectin, by Vector Laboratories (1 mentions)
Datura stramonium lectin, by Vector Laboratories (1 mentions)
Phaseolus vulgaris leucoagglutinin pha l, by Vector Laboratories (1 mentions)
23 protocols using sambucus nigra lectin sna
1
Quantitative Sialic Acid Labeling
2
Lectin Affinity Assay for Sialylated Proteins
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The lectin affinity assay was carried out according to a published protocol [32 (link)]. Accordingly, cell surface α-2,3 and α-2,6-sialylated antigen-expressing proteins were specifically captured using biotinylated Maackia amurensis lectin II (MALII) and Sambucus nigra lectin (SNA) (Vector Laboratories, Inc., Newark, CA, USA), respectively. Approximately 500 μg of total cell lysate protein were incubated (with rotation) with MALII or SNA for 16 h at 4 °C. The lectin–protein complex was captured using streptavidin-conjugated agarose beads. The beads were washed three times with radioimmunoprecipitation assay (RIPA) buffer before eluting the bound proteins with SDS-PAGE sample buffer. The protein samples obtained were subjected to Western blot analysis using Integrin-β1, -β3, -β4, -β5, -α4, -α5, and -αv antibody (Cell Signaling, Danvers, MA, USA, Integrin antibody sampler kit, #4749).
3
Siglec-E Regulation in Macrophages
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Fluorescein isothiocyanate (FITC), bovine serum albumin (BSA), 4',6-diamidino-2-phenylindole (DAPI) and Giemsa stain were obtained from Sigma (St. Louis, MO). Sialidase was from Roche Applied Science (Mannheim, Germany); Mounting medium was from Amersham Biosciences (Uppsala, Sweden); Sambucus Nigra lectin (SNA) and Maackia amurensis lectin (MAL) were from Vector Labs; 2'7'- dichloro dihydro fluorescein diacetate acetyl ester (H2DCFDA) was from Molecular probes (OR, USA); siglec-E siRNA was from santa cruz Biotechnology and DyNAmo ColorFlash SYBR Green qPCR kit was from Thermo Scientific (USA). All the cytokine ELISA kits, PE-rat anti-mouse CD14 and SHP-1 antibody were obtained from BD pharmingen and BD Biosciences (USA). Anti-Siglec-E antibody was from R&D systems (MN, USA); RNeasy Mini Kit was from Qiagen (Limburg, Netherlands); Reverse Transcriptase Kit was from Promega (WI, USA) and PCR reagent system was from Invitrogen (CA, USA). All other antibodies were from Cell Signaling Technologies (MA, USA), unless indicated otherwise.
4
Lectin Precipitation of Lipid Raft Proteins
5
Single-Cell Screening of CMAS and ST6Gal1 Knockouts
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Custom crRNA (IDT) was designed to target human CMAS (GAACACCCCCGATCTTCTCC) and ST6Gal1 (CAGATGGGTCCCATACAATT). Cells were seeded at 500,000 cells per well 1 day prior to transfection in a 6-well tissue culture plate. For one well of a 6-well plate, 20 pmol of Cas9 nuclease (IDT), 20 pmol of ATTO-550 labeled crRNA:tracrRNA (IDT) duplex, 8 μL Cas9 Plus reagent (IDT), and 16 μL CRISPRMAX reagent (Thermo Fisher) in 600 μL Opti-MEM medium (Gibco). One day after transfection, cells were removed from the plate by trypsin digestion, washed, resuspended in 300 μl of cell sorting medium (HBSS, 10% FBS, 1 mM EDTA), and stored on ice until sorting. Cells were sorted within the University of Alberta Flow Cytometry Core. The top 5% bright dyes stained with ATTO-550 were sorted into three 96-well plates containing regular culture medium at one cell per well. Cells were grown for ~2 weeks until a time when colonies were screened by flow cytometry using fluorescein-conjugated Sambucus Nigra Lectin (SNA, 1:750, Vector Laboratories).
6
SNA Lectin Staining and FACS Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cells were stained with Sambucus Nigra lectin (SNA) (Vector Laboratories Inc.) according to manufacturer protocol. Briefly, Cells were incubated with 10ug/ml FITC-conjugated Lectin at room temperature for 30 min. They were then washed twice in PBS and analyzed by FACS.
7
Real-time virus binding analysis by BLI
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Real-time virus binding was studied by BLI analysis using an Octet RED384 (Fortebio). All experiments were carried out at 30 °C in Dulbecco’s PBS with calcium and magnesium (PBS+/+) (Lonza) as standard assay buffer. BLI protocols are described stepwise in detail in ref. 46 (link). In short, SA biosensors were loaded with biotinylated receptors. These were either biotinylated synthetic glycans [2-6Sia-(LN)3, Siaα2-6Galβ1-4GlcNAcβ1-3Galβ1-4GlcNAcβ1-3Galβ1-4GlcNAc; 2-6Sia-(LN)2, Siaα2-6Galβ1-4GlcNAcβ1-3Galβ1-4GlcNAcβ1 or the Siaα2-3 versions 2-3Sia-(LN)3 or 2-3Sia-(LN)2 of these] or recombinant glycoprotein LAMP1 (2-6Sia-LAMP1 or 2-3Sia-LAMP 1). Receptors were loaded to saturating levels and real-time virus association was examined for 900 s in the presence of 10 µM oseltamivir carboxylate (OC; Roche) to block NA activity. Absolute initial virus-binding rates were calculated and plotted (nm/109 virus particles). LAMP1 sialylation levels were analyzed by lectin binding assays [(Maackia amurensis lectin I (MAL I, Vector Labs) binds to α2-3Sia-Galβ1-4GlcNAc; Sambucus nigra lectin (SNA, Vector Labs) binds preferentially to α2- 6Sia-Galβ1-4GlcNAc; and Erythrina cristagalli lectin (ECA, Vector Labs) binds to terminal LacNAc (Galβ1-4GlcNAc)].
8
Biotinylated Lectin Binding Assay
9
Lectin-Mediated Binding of Influenza Virus
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Pooled murine splenocytes were incubated in 200 µL of complete media with dilutions of 1:200, 1:100, or 1:20 Maackia amurensis lectin I (MAA‐1) or II (MAA‐2), or Sambucus nigra lectin (SNA) (Vector Laboratories, Burlingame, CA) for 30 min at 4 °C with 0.5 × 10−3m Ethylenediaminetetraacetic acid (EDTA) added to the culture media to reduce cell clumping. Cells were then washed and incubated with PR8‐FITC for 1 h at 37 °C in 200 µL RPMI, washed again, and incubated overnight in complete media at 37 °C. PR8‐FITC binding was then measured by flow cytometry.
10
Efficient NDV Cell Interaction via Sialic Acids
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
α2,3 and α2,6 N-linked Sias allow for efficient interaction of NDV with target cells [27 (link)]. SNA binds preferentially to Sias attached to terminal galactose through the α2,6 linkage and, to a lesser degree, α2,3 linkage. MAL1 binds to Gal (β-1,4) GlcNAc but tolerates the substitution of N-acetyllactosamine with Sia at the 3 position of galactose. After harvesting, cells were fixed with 4% PFA at room temperature for 30 min. Lectin staining was performed with fluorescein-labeled Maackia amurensis lectin I (MAL1; Vector Laboratories, San Mateo, CA, USA) and Sambucus nigra lectin (SNA; Vector Laboratories, CA, USA) according to the manufacturer’s instructions. MAL1 binds to Gal (β-1,4) GlcNAc but tolerates the substitution of N-acetyllactosamine with Sia at the 3 position of galactose, while SNA binds to α2,6-linked Sia. The respective lectins were added to the cell cultures, and the samples were incubated at 37 °C for 30 min and then rinsed three times with PBS. The binding of the labeled lectins to cells was detected using flow cytometry.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!