For transfection of miRNA oligonucleotides, cells were transfected with 50 nmol/ml of miRNA precursors or with a control no-targeting scrambled oligonucleotides (Ambion, Austin, TX) using siPORT neoFX Transfection Agent (Ambion). For the HMGA1P6 expression construct (pCAG-HMGA1P6) and the HMGA1P6 luciferase reporter construct (pGL3-HMGA1P6), the entire sequence of HMGA1P6 gene (ENST00000418454.1) was amplified by using the primers Fw HMGA1P6 5'-tcctctaattgggactccga-3' and Rev HMGA1P6 5'-ttactcagatcccaggcaga-3'. The amplified fragment was cloned into pCAG vector kindly given by Dr. S. Soddu, and into pGL3-Control firefly luciferase reporter vector (Promega), respectively. For the HMGA1P7 construct (pCAG-HMGA1P7) and the HMGA1P7 luciferase reporter construct (pGL3-HMGA1P6), the entire sequence of the HMGA1P7 gene (ENST00000406908.1) was amplified by using the primers Fw HMGA1P7 5'-agccagtcgagctggaggtc-3' and Rev HMGA1P7 5'-ctgcaatgtgtactcagagc-3'. The amplified fragment was cloned as described for the HMGA1P6 constructs. All the generated vectors were confirmed by sequencing. The Renilla luciferase vector (pRL-CMV), for transient transfection efficiency, was purchased from Promega. The 3' UTR region of the HMGA1 gene has been previously described [34 (link)].
Renilla luciferase vector prl cmv
Manufactured by Promega
Sourced in United States
The Renilla luciferase vector pRL-CMV is a plasmid that contains the Renilla luciferase gene under the control of the cytomegalovirus (CMV) immediate-early promoter. Renilla luciferase is a bioluminescent reporter protein that can be used to monitor gene expression in various cell-based assays.
Automatically generated - may contain errors
Lab products found in correlation
Dual luciferase reporter assay system, by Promega (8 mentions)
Dual luciferase reporter assay, by Promega (3 mentions)
Lipofectamine 2000, by Thermo Fisher Scientific (3 mentions)
Effectene transfection reagent, by Qiagen (3 mentions)
Lipofectamine 2000 transfection system, by Thermo Fisher Scientific (2 mentions)
Lipofectamine 3000 reagent, by Thermo Fisher Scientific (2 mentions)
Plenti utr luc vector, by Promega (2 mentions)
Siport neofx transfection agent, by Thermo Fisher Scientific (2 mentions)
Dual luciferase assay, by Promega (2 mentions)
Pmir report luciferase vector, by Thermo Fisher Scientific (2 mentions)
Pgl3 control firefly luciferase reporter vector, by Promega (1 mentions)
Dual luciferase kit, by Promega (1 mentions)
Pgl3 control luciferase reporter vector, by Promega (1 mentions)
Control no targeting scrambled oligonucleotides, by Thermo Fisher Scientific (1 mentions)
Biolux gaussia, by New England Biolabs (1 mentions)
Luciferase assay kit, by Promega (1 mentions)
Pgl3 promoter, by Promega (1 mentions)
Pgl3 promoter reporter vector, by Promega (1 mentions)
Pgl3 reporter vector, by Promega (1 mentions)
Nebnext high fidelity 2 pcr master mix, by New England Biolabs (1 mentions)
17 protocols using renilla luciferase vector prl cmv
1
Transfecting miRNA and HMGA1P6/P7 Constructs
2
Dual-Luciferase Assay for 3'UTR Activity
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Dual-luciferase reporter assay was performed in triplicate according to manufacturer's instructions (Promega, USA). Briefly, 5ng of Renilla luciferase vector (pRL-CMV; Promega, USA), an internal control, and 200ng of a pGL3 reporter which contained various region of ERα 3′UTR were co-transfected into MCF-7 RNPC1a overexpression (7-RNPC1a) and the control (7-NC) cells. Forty-eight hours after transfection, luciferase activity was measured with the dual luciferase kit according to manufacturer's procedure (Promega, USA). The fold change in relative luciferase activity is a ratio of the luciferase activity induced by 7-RNPC1a divided by that induced by 7-NC.
3
Luciferase Assay for 3'-UTR Regulation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The 3′-UTR of netrin-1 (Ntn1), erbB2 receptor tyrosine-protein kinase 4 (ErbB4) or protein kinase C α (Prkcα) was amplified and subcloned into the downstream region of the luciferase gene stop codon in the luciferase reporter vector to generate the p-Luc-UTR reporter plasmid (Promega Corporation, Madison, WI, USA). A total of 120 ng constructed p-Luc-UTR reporter plasmid was combined with 20 pmol miR-sc6 mimic and 20 ng Renilla luciferase vector pRL-CMV (Promega Corporation) to generate a mixture. On the day of the assay 293 cells were seeded onto 24-well plates and then transfected with the mixture using the Lipofectamine 2000 transfection system (Invitrogen; Thermo Fisher Scientific, Inc.), and subsequently cultured for an additional 24 h. The firefly and Renilla luciferase activities were measured using the dual-luciferase reporter assay system (Promega Corporation).
4
Transfection and Luciferase Assay for miRNA Targets
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For transfection of miRNA oligonucleotides, cells were transfected with 50 nmol/ml of miRNA precursors or with a control no-targeting scrambled oligonucleotides (Thermo Fisher Scientific Inc) using siPORT neoFX Transfection Agent (Thermo Fisher Scientific Inc). For transfection of Anti miR-16 oligonucleotides, cells were transfected with 50 nmol/ml of Anti miR-16 or with a control no-targeting scrambled oligonucleotides (Thermo Fisher Scientific Inc).
For Igf2 luciferase reporter construct (pGL3-Igf2), the miRNA seed sequence conteining fragment of Igf2 gene (ENSMUST00000000033) was amplified by using the primers:
Igf2 Fw 5′-aatttctagacccaaaatctcacttttccc-3′
Igf2 Rev 5′-aatttctagagatggcccataggtgtgctc-3′.
The amplified fragment was cloned into pGL3-Control luciferase reporter vector (Promega).
All the generated vectors were confirmed by sequencing. The Renilla luciferase vector (pRL-CMV), for transient transfection efficiency, was purchased from Promega.
For Igf2 luciferase reporter construct (pGL3-Igf2), the miRNA seed sequence conteining fragment of Igf2 gene (ENSMUST00000000033) was amplified by using the primers:
Igf2 Fw 5′-aatttctagacccaaaatctcacttttccc-3′
Igf2 Rev 5′-aatttctagagatggcccataggtgtgctc-3′.
The amplified fragment was cloned into pGL3-Control luciferase reporter vector (Promega).
All the generated vectors were confirmed by sequencing. The Renilla luciferase vector (pRL-CMV), for transient transfection efficiency, was purchased from Promega.
5
Validating miR-194-5p Regulation of SOX17
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Bioinformatics analysis with TargetScan, and luciferase reporter assays were conducted to verify that SOX17 was a direct target gene of miR-194-5p. For luciferase reporter assays, MCF-7 cells were seeded into 96-well plates at a density of 2×105 cells/well and grown to 70% confluence. Following the implementation of site-directed mutagenesis using the QuikChange Lightning Site-Directed Mutagenesis kit (Guangzhou RiboBio Biotechnology Co., Ltd.), cells were co-transfected with miR-194-5p mimic or miR-194-5p NC for 48 h at 37°C (50 ng; Guangzhou RiboBio Biotechnology Co., Ltd.), and SOX17-3' untranslated region (UTR)-wild-type (WT) (50 ng) or SOX17-3'UTR-mutant (MUT) (50 ng) plasmids (Guangzhou RiboBio Biotechnology Co., Ltd.) using Lipo6000™ Transfection Reagent (0.2 µl). Furthermore, transfection efficiency was normalized to a Renilla luciferase vector (pRL-CMV; Promega Corporation). The luciferase assay kit (BioLux®Gaussia; New England Biolabs, Inc., Ipswich, MA, USA) was used to evaluate lucif-erase activity according to the manufacturer's protocol.
6
Luciferase Assay for 3'-UTR Interactions
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The 3’-UTR sequence of Egfr, Cx3cl1, Cdk5r1, Rac2, or Plat was amplified from the genomic DNA and subcloned into the region directly downstream of the stop codon in the luciferase gene in the luciferase reporter vector. Overlap PCR was used to construct 3’-UTR mutant reporter plasmid. HEK 293T cells were cultured in 24-well plates and transfected with a mixture of p-Luc-UTR, miRNA mimics, and Renilla luciferase vector pRL-CMV (Promega, Madison, WI) using the Lipofectamine 2000 transfection system (Invitrogen). After 24 hours of incubation, luciferase activity was analyzed by the Dual-Luciferase Reporter Assay System according to the manufacturer’s protocols (Promega).
7
Dual-Luciferase Reporter Assay for CDK4 3'-UTR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Dual-luciferase reporter assay was performed according to manufacturer′s protocol(Promega, USA). The full length wild type CDK4 3'-UTR (wt) and mutant CDK4 3'-UTR (mut) was inserted into the pLenti-UTR-Luc vector (Promega, USA) and Renilla luciferase vector (pRLCMV; Promega, USA) was used as an internal control. The reporters were then transfected into PC3 and LNCaP WTAP overexpression cells (WTAP) and the control cells (NC) using Lipofectamine 3000 reagent (Invitrogen USA). After 48 hours of transfection, the luciferase activity was detected by Dual-luciferase reporter assay System (Promega, USA). Renilla luciferase activity was normalized against Fire y luciferase activity.
8
Dual-Luciferase Reporter Assay for CDK4 3'-UTR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Dual-luciferase reporter assay was performed according to manufacturer′s protocol(Promega, USA). The full length wild type CDK4 3'-UTR (wt) and mutant CDK4 3'-UTR (mut) was inserted into the pLenti-UTR-Luc vector (Promega, USA) and Renilla luciferase vector (pRLCMV; Promega, USA) was used as an internal control. The reporters were then transfected into PC3 and LNCaP WTAP overexpression cells (WTAP) and the control cells (NC) using Lipofectamine 3000 reagent (Invitrogen USA). After 48 hours of transfection, the luciferase activity was detected by Dual-luciferase reporter assay System (Promega, USA). Renilla luciferase activity was normalized against Fire y luciferase activity.
9
Luciferase Reporter Assay for 3'-UTR Regulation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The 3¢ untranslated region (3¢-UTR) of endothelin 1 (Edn1), Shroom, contactin 2 (Cntn2), Astn1, or Adam10 was amplified by polymerase chain reaction (PCR) using rat genomic DNA as a template. The PCR products were subcloned into the region directly downstream of the stop codon in the luciferase gene in the luciferase reporter vector to generate p-Luc-UTR reporter plasmid. An overlap PCR method was used to construct a 3¢-UTR mutant reporter plasmid with a pair of mutant primers (CCTAAGTCTTACATAGGTCCAATGGACCTATA, CATTGGACCTATGTAAGACTTAGGTCTCTC), and the sequence CTTACA in the wild-type 3¢-UTR of Astn1 corresponding to the seed region of miR-sc3 was replaced by the sequence of CTATGT. The sequences of wild-type and mutant 3¢-UTR were confirmed by sequencing. HEK 293T cells were seeded in 24-well plates and transfected with a mixture of 120 ng p-Luc-UTR, 20 pmol synthetic miRNA, and 20 ng Renilla luciferase vector pRL-CMV (Promega, Madison, WI, USA) following the recommended protocol for the Lipofectamine 2000 transfection system (Invitrogen). After 36 h of incubation, firefly and Renilla luciferase activities were measured from the cell lysates using the dual-luciferase reporter assay system (Promega).
10
Validation of miR-124-5p targeting HMGB1
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The target relationship between miR-124-5p and HMGB1 as well as the binding site of miR-124-5p and HMGB1 3ʹuntranslated region (3ʹUTR) were forecasted by bioinformatics software (http://www.targetscan.org/vert_72 ). TM The 3′UTR of HMGB1 containing the miR-124-5p binding sites was cloned into pMIR-Report Luciferase vector (Ambion, Austin, TX, USA) downstream of the firefly luciferase gene to generate the wild-type（WT）3′UTR luciferase reporter vector. Subsequently, the mutant-type (MUT) 3′UTR luciferase reporter vector was developed by the site-directed mutagenesis with the QuikChange Site-Directed Mutagenesis kit (Stratagene, La Jolla, CA, USA). The 293 T cells were seeded onto 24-well plates. The cells reaching 70–80% confluence were co-transfected with WT or MUT 3′UTR-Luc reporter vector and miR-124-5p mimic by using Lipofectamine 2000 (Invitrogen). The pRL-CMV Renilla luciferase vector (Promega, Madison, WI, USA) was utilized to normalize the cell numbers and transfection efficiency. After an additional 48 h, the luciferase activity was detected by using the dual luciferase assay (Promega). Each reaction was run in triplicate.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!