Total RNA from AGS cells was extracted with TRIzol Reagent (Life Technologies, Carlsbad, CA, USA) according to the manufacturer’s protocol. Purification of mRNA from AGS cells was performed using Oligotex-dT30 Super mRNA Purification Kit (TAKARA, Kusatsu, Japan) according to the manufacturer’s protocol. DNA purified from AGS cells was sonicated to 1000–3000 bp and extracted by phenol/chloroform. To make ssDNA, the dsDNA was boiled. Poly I:C HMW (InvivoGen, San Diego, CA, USA) was prepared according to the manufacturer’s protocol. Synthetic oligos were designed to the backbone of pBlueScript II KS (+) (Stratagene, La Jolla, CA, USA) for 20 nt (5′TATTGTCTCATGAGCGGATA3′) and 100 nt ssDNA (5′TATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAA3′). 1000 nt ssDNA was prepared by boiling the PvuI-PvuI fragment of pBlueScript II KS (+). Linearized 3000 bp dsDNA was prepared by digesting the pBlueScript II KS (+) plasmid with EcoRV. 3000 nt ssDNA was prepared by boiling the 3000 bp dsDNA. Salmon sperm DNA (Sigma-Aldrich, St. Louis, MO, USA) was extracted by phenol and then phenol/chloroform, sonicated to 1000 bp–3000 bp and re-extracted by phenol/chloroform.
Oligotex dt30 super mrna purification kit
Manufactured by Takara Bio
Sourced in Japan
The Oligotex-dT30 Super mRNA Purification Kit is a laboratory equipment used for the isolation and purification of messenger RNA (mRNA) from various biological samples. It utilizes oligo(dT) magnetic beads to selectively capture and isolate the polyadenylated mRNA molecules, allowing for their separation from other cellular components.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (2 mentions)
Poly 1 c hmw, by InvivoGen (1 mentions)
Salmon sperm dna, by Merck Group (1 mentions)
Smarter race cdna amplification kit, by Takara Bio (1 mentions)
Pmd19 t, by Takara Bio (1 mentions)
Abi 3730xl sequencer, by Thermo Fisher Scientific (1 mentions)
Primescript double strand cdna synthesis kit, by Takara Bio (1 mentions)
Megascript sp6 transcription kit, by Thermo Fisher Scientific (1 mentions)
Isogen reagent, by Nippon Gene (1 mentions)
Pgem t easy vector, by Promega (1 mentions)
Rna seq, by Novogene (1 mentions)
Hiseq 2500 platform, by Novogene (1 mentions)
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (1 mentions)
6 protocols using oligotex dt30 super mrna purification kit
1
Extraction and Purification of Nucleic Acids
2
Isolation and Characterization of Dehydrin Gene CdDHN4 from Bermudagrass
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from bermudagrass ‘Tifway’ using TRIzol Reagent (Invitrogen, USA), and mRNA enrichment was performed using the Oligotex –dT30(super) mRNA Purification Kit (TaKaRa, Japan). The full-length cDNA of CdDHN4 was obtained using the SMARTer™ RACE cDNA Amplification Kit (Clontech, USA) following the manufacturer's instructions. The primers for RACE were designed based on the partial sequence of CdDHN (Table 1 ). Because the EST of CdDHN is very similar to that of barley DHN4, we named it CdDHN4 (Zhou et al., 2014 (link)). The PCR products were cloned into pMD 19-T (TaKaRa) and sequenced.Table 1
Primers used for PCR amplification.
| Primer | Nucleotide sequence (5′-3′) | Function |
|---|---|---|
| 3A1 | GCGAACAGTCCGTGATAACTGTCTGTCA | 3′ RACE; outer |
| 3A2 | TCGTGTAACATGATAAGATGGTCAGCCA | 3′ RACE; inner |
| 5S1 | ACCATCTTATCATGTTACACGAACGTCG | 5′ RACE; outer |
| 5S2 | GAACGTCGTGACAGACAGTTATCACGGA | 5′ RACE; inner |
| qRT-S | TCGTCTGAGGATGATGGC | Real-time PCR |
| qRT-A | TGTCCTTGCTGACCGTAG | Real-time PCR |
| 18S-S | GTGACGGGTGACGGAGAATT | Real-time PCR |
| 18S-A | GACACTAATGCGCCCGGTAT | Real-time PCR |
| ORF-S | ATGGAGCACCAGGGACAGTACGGC | Amplification of ORF |
| ORF-A | TGTCCATGATGCCCTTCTTCTCGC | Amplification of ORF |
| Dehydrin_CS | AA | Amplification of ORF for expression |
| Dehydrin_CA | A | Amplification of ORF for expression |
3
Isolation and Characterization of hps4.L Transcripts
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from the tails of wild‐type and mutant tadpoles (stage 47) and purified using the ISOGEN reagent with spin columns (Nippon Gene, Tokyo, Japan). Poly(A)+ mRNA was isolated using the Oligotex‐dT30 Super mRNA Purification Kit (Takara Bio). Double‐stranded cDNA was synthesized using the PrimeScript Double Strand cDNA Synthesis Kit (Takara Bio).
To isolate hps4.L transcripts from the wild type and the periodic albino mutant, polymerase chain reaction (PCR) was carried out using the following primers: 5′‐ATGGCATCCTCTATTCCTACTG‐3′ and 5′‐TTACAGCAGGTTAAGACCATG‐3′. The conditions for PCR were 94°C for 2 min 20 s, 40 cycles of 94°C for 50 s, 51°C for 50 s and 72°C for 2 min 15 s, followed by 72°C for 5 min. PCR products were subcloned into the pGEM‐T Easy Vector (Promega) and sequenced using the ABI 3730xl sequencer (Applied Biosystems).
Wild‐type hps4.L (DDBJ Accession Number: LC577762) and mutant hps4.L (DDBJ Accession Number: LC577763) cDNA fragments were used to prepare mRNAs for embryo microinjection. Synthetic capped hps4.L mRNAs were generated using the MEGAscript SP6 Transcription Kit (Ambion).
To isolate hps4.L transcripts from the wild type and the periodic albino mutant, polymerase chain reaction (PCR) was carried out using the following primers: 5′‐ATGGCATCCTCTATTCCTACTG‐3′ and 5′‐TTACAGCAGGTTAAGACCATG‐3′. The conditions for PCR were 94°C for 2 min 20 s, 40 cycles of 94°C for 50 s, 51°C for 50 s and 72°C for 2 min 15 s, followed by 72°C for 5 min. PCR products were subcloned into the pGEM‐T Easy Vector (Promega) and sequenced using the ABI 3730xl sequencer (Applied Biosystems).
Wild‐type hps4.L (DDBJ Accession Number: LC577762) and mutant hps4.L (DDBJ Accession Number: LC577763) cDNA fragments were used to prepare mRNAs for embryo microinjection. Synthetic capped hps4.L mRNAs were generated using the MEGAscript SP6 Transcription Kit (Ambion).
4
Transcriptome Analysis of FTO Knockdown
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from FTO knockdown HOC313 cells using TRIzol reagent (cat. no. 15596-018; Thermo Fisher Scientific). A 2 mg sample of total RNA was subjected to mRNA purification using an Oligotex-dT30 Super mRNA purification kit (TaKaRa). Purified mRNA was fragmented into ~150 nt pieces by incubating with fragmentation buffer provided with the NEB Fragmentation Kit (NEB) at 94 C for 5 min. Fragmented mRNA was concentrated by ethanol precipitation, and half was submitted for RNA-seq (Novogene) and the other half was used for m 6 A immunoprecipitation followed by RNA-seq (MeRIP-seq). The library was prepared and sequenced using the HiSeq 2500 platform by Novogene.
5
Zebrafish Pineal, Brain, and Eye mRNA Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
mRNA from pineal organ, brain, and eye of zebrafish was purified with an Oligotex -dT30 Super mRNA Purification Kit (TaKaRa, Otsu, Japan), and the mRNAs were reverse transcribed to cDNAs with a High Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Waltham, Massachusetts, USA). The β-actin genes were used as internal references. The primer sequences used for amplification of each gene and the length of amplicons are as follows. 5′-TGCGGCAGGTGAGTCGTCTG-3′ and 5′-GATCCCTGAACTGTCTGTTC-3′ for amplification of a 270-bp fragment of PP1, 5′-GCTGAGACAAGTTGCTAAGG-3′ and 5′-ACCTCTGGAACTGTTTGTTC-3′ for amplification of a 225-bp fragment of PP2, 5′-TCGATTGCAGGTCTTGTGAC-3′ and 5′- TGGGTGGACTCTGACTCGGC-3′ for amplification of a 380-bp fragment of SWS1 opsin, and 5′-TGGAGAAGAGCTATGAGCTG-3′ and 5′-ACTCATCGTACTCCTGCTTG-3′ for amplification of a 386-bp fragment of β-actin.
6
Purification and Sequencing of Poly(A)+ RNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To collect brain or liver total RNA, immediately following ribosome profiling tissue lysis, a fraction of tissue lysate was mixed with TRI Reagent, and total RNA was extracted. Polyadenylate [poly(A)] + RNA was collected from total RNA using the oligotex-dT30 Super mRNA Purification Kit (TaKaRa). Poly(A) + RNA was fragmented and collected by incubation in alkaline buffer (88 mM NaHCO3, 12 mM Na2CO3, and 1 mM EDTA) at 95°C for 45 min, followed by ethanol precipitation. Poly(A) + RNA fragments were resolved by denaturing urea PAGE, and fragments of 20 to 40 nt were gel-excised and extracted. 3′ adaptor ligation, library preparation, and sequencing were performed in the same way as ribosome profiling. Using Galaxy (53 (link)), fastq files were filtered by quality, 3′ adaptor sequence (CTGTAGGCACCATCAAT) was removed, and mRNA reads were retrieved by aligning to mouse RefSeq mRNAs. mRNA reads were aligned, counted, and analyzed using HISAT2, HTSeq-count, and DESeq2.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!