Log In Sign up
The largest database of trusted experimental protocols

Platinum sybr green qpcr supermix udg with rox kit

Manufactured by Thermo Fisher Scientific
Visit Supplier
Sourced in United States

The Platinum SYBR Green qPCR SuperMix-UDG with Rox kit is a ready-to-use solution for real-time quantitative PCR (qPCR) analysis. It contains all the necessary components, including a DNA polymerase, SYBR Green I dye, and ROX passive reference dye, to perform highly sensitive and accurate qPCR experiments.

Automatically generated - may contain errors

Lab products found in correlation

Trizol reagent, by Thermo Fisher Scientific (3 mentions) Superscript 3 first strand synthesis kit, by Thermo Fisher Scientific (3 mentions) Superscript 3 first strand synthesis supermix for qrt pcr kit, by Thermo Fisher Scientific (2 mentions) Nanodrop 2000 nano spectrophotometer, by Thermo Fisher Scientific (2 mentions) Dnase 1, by Promega (2 mentions) 7900ht fast real time pcr system, by Thermo Fisher Scientific (2 mentions) Rneasy kit, by Qiagen (2 mentions) Rneasy mini kit, by Qiagen (1 mentions) Goscript reverse transcription system, by Promega (1 mentions) Rnaqueous micro total rna isolation kit, by Thermo Fisher Scientific (1 mentions) Superscript 3 first strand synthesis supermix kit, by Thermo Fisher Scientific (1 mentions) Verso cdna ki, by Thermo Fisher Scientific (1 mentions) Viia7 machine, by Thermo Fisher Scientific (1 mentions)

Close spelling variants of this product

Platinum SYBR Green qPCR SuperMix-UDG with ROX Platinum® qPCR SuperMix-UDG with Rox Platinum SYBR Green qPCR SuperMix-UDG kit Platinum SYBR Green qPCR SuperMix-UDG SYBR Green qPCR SuperMix-UDG kit Platinum SYBR qPCR SuperMix-UDG Platinum SYBR Green SuperMix-UDG SuperMix (Platinum SYBR Green qPCR Kit Platinum qPCR SuperMix-UDG kit Platinum SYBR Green qPCR SuperMix

11 protocols using platinum sybr green qpcr supermix udg with rox kit

1

Quantitative RT-PCR for Viral Titers

Check if the same lab product or an alternative is used in the 5 most similar protocols
Viral titers in cell extracts and supernatant fluid were estimated by quantitative RT-PCR (RT-qPCR). Total RNA was extracted using RNeasy minikit according to the manufacturer's instructions (Qiagen). Reverse transcriptions were performed using GoScript reverse transcription system (Promega). Obtained cDNAs were diluted 1:10. Quantitative PCR (qPCR) was performed using Platinum SYBR Green qPCR SuperMix-UDG with ROX kit (Invitrogen). qPCR was run on the ABI 7000 PCR system (Applied Biosystems) using the following protocol: (i) 5 min at 95°C; (ii) 40 cycles with 1 cycle consisting of 15 s at 95°C and 1 min at 60°C; (iii) f a melting curve up to 95°C at 0.8°C intervals. A standard reference (2019-nCoV Positive Control-nCoVPC from “the CDC 2019-nCoV Real-Time” kit) was included in each run to standardize results.
Outlaw V.K., Bovier F.T., Mears M.C., Cajimat M.N., Zhu Y., Lin M.J., Addetia A., Lieberman N.A., Peddu V., Xie X., Shi P.Y., Greninger A.L., Gellman S.H., Bente D.A., Moscona A, & Porotto M. (2020). Inhibition of Coronavirus Entry In Vitro and Ex Vivo by a Lipid-Conjugated Peptide Derived from the SARS-CoV-2 Spike Glycoprotein HRC Domain. mBio, 11(5), e01935-20.
+ Open protocol
+ Expand
2

Quantifying Lung Inflammatory Cytokines

Check if the same lab product or an alternative is used in the 5 most similar protocols
The expressions of TNF-α and IFN-γ mRNAs of lung tissues were analyzed by quantitative real-time polymerase chain reaction (qRT-PCR). Total RNA was extracted by using TRIzol reagent (Ambion, California, US) according to the instructions; concentration and integrity of total RNA were verified by a NanoDrop2000 nanospectrophotometer (Thermo, MA, USA) and electrophoresis in 2% agarose gel. Reverse transcription (RT) was proceeded by using SuperScript® III First-Strand Synthesis SuperMix for qRT-PCR Kit (Invitrogen, California, US), and real-time PCR reactions were performed by using Platinum® SYBR® Green qPCR SuperMix-UDG with ROX Kit (Invitrogen, California, US). The reaction systems were prepared following the instructions of the kits and reacted on an ABI 7500 real-time instrument (ABI, California, US). The initial enzyme activation step was at 95°C for 2 min, followed by 40 cycles of 95°C for 15 s and 60°C for 30 s. At the end of PCR, to evaluate specific amplification of the target genes, melting curves ranging from 60 to 95°C were also included in each run. The primers of TNF-α and IFN-γ were designed and synthesized by Genscript Biotech Co. Ltd (Nanjing, Jiangsu, China). Sequences were shown in Table 3.
Li M., Li Y., Li J., Zhao P., Bai Y., Feng S., Liu X., Wang Y., Bian Q, & Li J. (2017). Long-Term Effects of TCM Yangqing Kangxian Formula on Bleomycin-Induced Pulmonary Fibrosis in Rats via Regulating Nuclear Factor-κB Signaling. Evidence-based Complementary and Alternative Medicine : eCAM, 2017, 2089027.
+ Open protocol
+ Expand
3

RNA Extraction and qRT-PCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
RNA was extracted using the RNAqueous® micro-total RNA isolation kit (Ambion (CA), Life Technologies). cDNA was made from 1.5 μg DNase-1 (Promega)-treated RNA using the Superscript III first-strand synthesis kits (Invitrogen). qRT-PCR was performed using Platinum SYBR Green qPCR SuperMix-UDG with Rox kit (Invitrogen). The level of gene expression was normalised to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) at time zero or untreated conditions using the ΔCt method95 (link). The list of primers used is included in Table S3.
Jansson D., Dieriks V.B., Rustenhoven J., Smyth L.C., Scotter E., Aalderink M., Feng S., Johnson R., Schweder P., Mee E., Heppner P., Turner C., Curtis M., Faull R, & Dragunow M. (2021). Cardiac glycosides target barrier inflammation of the vasculature, meninges and choroid plexus. Communications Biology, 4, 260.
+ Open protocol
+ Expand
4

Quantitative RT-qPCR for Mouse Chondrocytes

Check if the same lab product or an alternative is used in the 5 most similar protocols
The mouse chondrocytes were subjected to Trizol reagent to extract the total RNA following the manufacture’s instruction. After quantifying by NanoDrop spectrophotometer, the equal amount of total RNA was utilized to reverse transcription to cDNA using SuperScript® III First-Strand Synthesis SuperMix kit (Invitrogen). The cDNA product was then amplified using Platinum® SYBR Green qPCR SuperMix-UDG with Rox kit (Invitrogen) depending on the primers (PrimerBank). The copy numbers of each gene were calculated by cycle threshold (ΔCt) methods. Means of the copy numbers of GAPDH were employed as internal controls to normalize the data.
Wei Z., Dong C., Guan L., Wang Y., Huang J, & Wen X. (2020). A metabolic exploration of the protective effect of Ligusticum wallichii on IL-1β-injured mouse chondrocytes. Chinese Medicine, 15, 12.
+ Open protocol
+ Expand
5

Quantitative RT-PCR for Gene Expression

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
Quantitative reverse transcriptase polymerase chain reaction (qRT-PCR) was performed as described previously [19 (link)]. At endpoint, cells were rinsed 2× with PBS then TRIzol® (1 ml/well) was added and lysates were transferred to screw cap tubes. Chloroform (200 μl) was added and tubes were shaken to mix. Samples were centrifuged, the aqueous layer was transferred to a new tube and an equal volume of 70% ethanol (EtOH) was added. RNA was then extracted using RNeasy kits (Qiagen Inc. Venlo, Limburg, Nethlands). cDNA was made from 3μg DNase-1 (Promega, Madison, WI, USA) treated RNA using the Superscript III first strand synthesis kit (Invitrogen, Calrsbad, CA, USA). qRT-PCR was performed using Platinum SYBR Green qPCR SuperMix-UDG with Rox kit (Invitrogen). Standard curves were performed for all primers used; sequences and efficiencies are included in Additional file 2: Table S2. The level of gene expression was normalized to GAPDH at time zero or untreated conditions using the ΔCt method [25 (link)].
Jansson D., Rustenhoven J., Feng S., Hurley D., Oldfield R.L., Bergin P.S., Mee E.W., Faull R.L, & Dragunow M. (2014). A role for human brain pericytes in neuroinflammation. Journal of Neuroinflammation, 11, 104.
+ Open protocol
+ Expand
6

Total RNA Extraction and qPCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA extraction was carried out using Trizol reagent (Invitrogen) according to the manufacturer’s instruction. Two microgram of total RNA was subjected to reverse Transcription (RT) using Verso cDNA Ki (Thermo Scientific). Real-time quantitative PCR was conducted by Platinum SYBR Green qPCR SuperMix UDG with ROX kit (Invitrogen) in 20 μl and ABI 7300 real-time PCR thermal cycle instrument (ABI, USA) according to the supplied protocol. The primers for MEK5 were: (F, CTTTAATGCCTCTCCAGCTTCT; R, CCATCATTGAACTGCACGAT). The relative expression levels were normalized to expression of endogenous GAPDH. (Primers: F, GGGAAACTGTGGCGTGAT; R, GAGTGGGTGTCGCTGTTGA).
Diao D., Wang L., Wan J., Chen Z., Peng J., Liu H., Chen X., Wang W, & Zou L. (2016). MEK5 overexpression is associated with the occurrence and development of colorectal cancer. BMC Cancer, 16, 302.
+ Open protocol
+ Expand
7

Quantitative RT-PCR for Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
Target gene expression levels were evaluated by quantitative RT-PCR using a 7900HT Fast Real Time PCR system (Applied Biosystems, Singapore). Total RNA was isolated at designated time points using the RNeasy kit (Qiagen Inc.) and stored at −80 °C until further use. cDNA synthesis was performed with SuperScript III first strand synthesis kit (Invitrogen) using approximately 3 μg of DNase I-treated (Promega) RNA, and subjected to qRT-PCR using Platinum SYBR Green qPCR SuperMix-UDG with Rox kit (Invitrogen). The primers are detailed in Table S4 and the relative changes were analysed according to the ∆CT method72 (link). Each PCR run included a negative RT and non-template control, as well as melting curve assays to confirm specific product amplification. The plotted data represent the mean values of at least 3 independent experiments ± SEM.
Park T.I., Feisst V., Brooks A.E., Rustenhoven J., Monzo H.J., Feng S.X., Mee E.W., Bergin P.S., Oldfield R., Graham E.S., Curtis M.A., Faull R.L., Dunbar P.R, & Dragunow M. (2016). Cultured pericytes from human brain show phenotypic and functional differences associated with differential CD90 expression. Scientific Reports, 6, 26587.
+ Open protocol
+ Expand
8

Quantitative Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Target gene expression levels were evaluated by quantitative reverse-transcription polymerase chain reaction (qRT-PCR) using a 7900HT Fast Real Time PCR system (Applied Biosystems, Singapore). The complementary DNA produced above was analysed for qRT-PCR using Platinum SYBR Green qPCR SuperMix-UDG with Rox kit (Invitrogen). The primers are detailed in Supplementary Table 4 and the relative changes were analysed according to the 2−ΔΔCT method (Livak and Schmittgen, 2001 (link)). Each PCR run included a negative RT and non-template control, as well as melting curve assays to confirm specific product amplification. The plotted data represent the mean values of at least three independent experiments ± standard error of the mean (SEM).
Park T.I., Schweder P., Lee K., Dieriks B.V., Jung Y., Smyth L., Rustenhoven J., Mee E., Heppner P., Turner C., Curtis M.A., Faull R.L., Montgomery J.M, & Dragunow M. (2020). Isolation and culture of functional adult human neurons from neurosurgical brain specimens. Brain Communications, 2(2), fcaa171.
+ Open protocol
+ Expand
9

RNA Extraction and Real-Time PCR Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols
The primers were designed and synthesized by Genscript Biotech Co. Ltd. (Nanjing, China). Total RNA was extracted by using TRIzol reagent (Ambion, Foster City, CA, United States) according to the instructions. Concentration and integrity of total RNA were verified by a NanoDrop 2000 nano-spectrophotometer (Thermo, Waltham, MA, United States). Reverse transcription (RT) was proceeded by using SuperScript® III First-Strand Synthesis Super Mix for qRT-PCR Kit (Invitrogen, Carlsbad, CA, United States), and real-time PCR reactions were performed using Platinum® SYBR® Green qPCR SuperMix-UDG with ROX Kit (Invitrogen, Carlsbad, CA, United States). The reaction systems were prepared following the instructions of the kits and reacted on an Applied Biosystems 7500/7500 Fast Real-Time PCR System (AB, Foster City, CA, United States). The initial enzyme activation step was at 95°C for 2 min, followed by 40 cycles of 95°C for 15 s, 60°C for 30 s. At the end of PCR, to evaluate specific amplification of the target genes, melting curve ranging from 60 to 95°C were also included in each run.
Bai Y., Li J., Zhao P., Li Y., Li M., Feng S., Qin Y., Tian Y, & Zhou T. (2018). A Chinese Herbal Formula Ameliorates Pulmonary Fibrosis by Inhibiting Oxidative Stress via Upregulating Nrf2. Frontiers in Pharmacology, 9, 628.
+ Open protocol
+ Expand
10

Quantitative Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
A total of 1000 ng of RNA was converted into cDNA using
High-Capacity RNA-to-cDNA Kit (Applied Biosystems) in accordance with the
manufacturer’s instructions.
The cDNA was amplified using the Platinum SYBR Green qPCR Supermix
– UDG with ROX kit (Invitrogen, USA) using ViiA7machine (Applied Biosystems, UK). The master mix provided is composed of
AmpliTaq® DNA Polymerase and SYBR® Green cyanine dye, which as
a result of binding to DNA absorbs blue light λmax = 497 nm) and
emits green light (λmax = 520 nm). General reaction conditions are
shown below.
We quantifed the gene expression data using the ΔΔCT
method. The relative quantification measures the relative change in mRNA
expression levels of a gene by comparing to the levels of another RNA. This
method does not require a calibration curve and the gene expression is
compared against a reference gene. In this study we chose as reference gene
GAPDH, an endogenously expressed gene.
The gene expression has been calculated following specifically
ΔΔCT which assumes that each PCR cycle will doubles the amount
of amplicons in the reaction (amplification efficiency = 100%) (Livak and
Schmittgen, 2001). The fold change expression values have been calculated
using this formula: Fold change expression
=2”ΔΔCt where
ΔΔCt = [ΔCt sample l - ΔCt
sample2] and ΔCt = [Ct sample – Ct
endogenous control].
Erkek S., Johann P.D., Finetti M.A., Drosos Y., Chou H.C., Zapatka M., Sturm D., Jones D.T., Korshunov A., Rhyzova M., Wolf S., Mallm J.P., Beck K., Witt O., Kulozik A.E., Frühwald M.C., Northcott P.A., Korbel J.O., Lichter P., Eils R., Gajjar A., Roberts C.W., Williamson D., Hasselblatt M., Chavez L., Pfister S.M, & Kool M. (2018). Comprehensive analysis of chromatin states in atypical teratoid/rhabdoid tumor identifies diverging roles for SWI/SNF and Polycomb in gene regulation. Cancer cell, 35(1), 95-110.e8.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!