Image studio lite

AGO2 cleavage assay was performed as previously described by Gregory et al. (83 (link)) and the following modifications. Oligo RNAs were purchased from Integrated DNA Technologies (IDT): dme-let-7a-5p_guide (/5Phos/UGAGGUAGUAGGUUGUAUAGU), dme-let-7a-3p_passenger
(/5Phos/UAUACAAUGUGCUAGCUUUCU), and dme-let-7a_target (/5IRD700/UAUACAACCUACUACCUCAUU). miRNA duplex was prepared by mixing equal volumes of both dme-let-7a-5p_guide and dme-let-7a-3p_passenger oligos in annealing buffer [10 mM tris (pH 8), 50 mM NaCl, and 1 mM EDTA], incubating at 95°C for 3 min and cooling gradually to room temperature for 1 hour. Either 0.025 μg of rAGO2 (Active Motif, #31486) or rAGO2 in combination with increasing concentrations of affinity-purified Flag-INTS11 was preincubated with the 5 nM miRNA duplex in buffer containing 3.2 mM MgCl₂, 1 mM adenosine triphosphate, 20 mM creatine phosphate, RNasin (0.2 U/μl), 20 mM tris-HCl (pH 8), 0.1 M KCl, and 10% glycerol for 30 min at 37°C. Then, 10 nM dme-let-7a_target was added, and the cleavage reaction was incubated for 90 min at 37°C and stopped by adding proteinase K for 30 min at room temperature. Samples were loaded onto a 15% TBE-urea gels (Bio-Rad, #4566055), visualized using the Odyssey CLx Imaging System, and quantified by Image Studio Lite (v5.2).