Centricon ym 10

Native G protein (transducin) was extracted from bovine rod outer segments^{52 (link)}. Briefly, ROS from 100 retinae were re-suspended in isotonic buffer 20 mM BTP (pH 7.0), 120 mM KCl, 0.2 mM MgCl₂, 5 mM DTT at 4 mg rhodopsin mL⁻¹. Subsequently, they were homogenized, pelleted and re-suspended in hypotonic buffer 5 mM Tris–HCl (pH 7.0), 5 mM DTT at 1 mg rhodopsin mL⁻¹ without any detergents. Subsequent exposure to bright orange light (filter GG495) for 10 min resulted in a tight membrane–transducin complex, allowing removal of PDE6 in two consecutive centrifugal washing steps (90,000 × g, 30 min, 4 °C). The PDE6 free pellet was incubated with 150 µM GTP and 50 µM MgCl₂ for 10 min to allow dissociation of G-protein into its subunits and from the membranes. Gα and Gβγ subunits were separated on Blue-Sepharose column (1 mL HiTrap Blue, GE Healthcare, Germany) in buffer 20 mM BTP (pH 7.5), 1 mM MgCl₂, 2 mM DTT in a continuous NaCl gradient (0–300) for 25 mL followed by step gradient 1 M for another 25 mL^{53 (link)}. Separated subunits were concentrated to 20 µM (centricon YM10, Millipore). GαGTPγS (Gα*) was prepared by activation of isolated Gα (20 µM) with twofold molar excess of GTPγS (10 min incubation at room temperature) in presence of 0.5 µM rhodopsin in isolated disc membranes. After removal of the membranes by centrifugation, isolated Gα* was stored at −40 °C.

Cell lysates, cultured media (either directly or concentrated 20× by filter centrifugation with 10 KDa cut-off Centricon YM-10; Millipore), isolated EVs, or EV fractions were analyzed by immunoblot. Denaturing and reducing conditions (0.5% SDS, 25 mM DTT) were used to solubilize proteins prior to electrophoresis in order to detect ApoD. Proteins were transferred to PVDF membranes using standard procedures, and exposed to rabbit serum anti-human ApoD (custom made by Abyntek Biopharma against purified ApoD; Ruiz et al., 2013 (link)), goat serum anti-mouse ApoD (Santa Cruz Biotechnology), rabbit serum anti-CD81 (GeneTex), mouse anti-flotillin 1 (Becton Dickinson), or rabbit serum anti-BiP (Sigma), and followed by HRP-conjugated secondary antibodies (Santa Cruz Biotechnology). Membranes were developed with ECL reagents (Millipore) and the signal visualized with a digital camera (VersaDoc; BioRad). The integrated optical density of the immunoreactive protein bands was measured in images taken within the linear range of the camera, avoiding signal saturation.

Purified Hpy GS was concentrated to 41 mg mL⁻¹ using Centricon YM-10 (Millipore, USA) for crystallization trials. Initial screening was performed by the sitting-drop vapour diffusion method using 96-well CrystalQuick plates (Greiner Bio-One, Germany) with various commercial screens (Hampton Research, USA; Qiagen, Germany; Axygen, USA; Emerald Biosystems, USA). Each sitting drop was prepared by mixing 0.75 µl protein solution and 0.75 µl reservoir solution and incubated at room temperature. The initial crystals of Hpy GS were grown after four weeks of incubation under several conditions with polyethylene glycol (PEG) 6,000. The crystals of Hpy GS were further optimized, and the best crystals were grown in 10% (v/v) PEG 6,000, 100 mM HEPES pH 7.0, and 50 mM choline. To obtain the cocrystals with substrates, Hpy GS was concentrated to 19 mg mL⁻¹ and mixed with 5 mM ATP, 5 mM PPT, and 5 mM magnesium chloride before crystallization. It was stored at 277 K for 1 h. The crystals of substrate-bound Hpy GS were grown in 2.0 M sodium formate and 100 mM sodium citrate at pH 5.0.

DNA cloning, expression, and purification of Tma Rex has been recently described by Park et al. [21 (link)]. The purified Tma Rex was concentrated up to 36 mg mL⁻¹ for crystallization using Centricon YM-10 (Millipore). To obtain crystals of the ternary complex Tma Rex, 22-bp duplex oligonucleotides (5′–ATTTGAGAAATTTATCACAAAA–3′ and 5′–TTTTGTGATAAATTTCTCAAAT–3′) containing a promoter region of the TM0201 gene regulated by Tma Rex were chosen. The oligonucleotides were dissolved in 200 mM NaCl, 1 mM MgCl₂, 20 mM Tris-HCl at pH 8.0, and 5% (v/v) glycerol solution and mixed with Tma Rex at a molar ratio of 1.2:2 (1 oligonucleotide: 1 dimeric protein). Crystallization was performed by the sitting-drop vapor diffusion method at 296 K using 96-well CrystalQuick plates (SWISSCI MRC, UK). Each sitting-drop was prepared by mixing equal volumes (0.75 μL) of the reservoir solution and ternary complex. The ternary complex crystals were obtained by co-crystallization with 1 mM NAD⁺ and were grown in 0.05 M Bis-Tris buffer pH 6.5 and 45% (v/v) polypropylene glycol P400.